Labshake search
Citations for Agilent :
801 - 850 of 1560 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: NGS PCR amplicons from RNA guided cleavage reactions were evaluated using D1000 automated electrophoresis (TapeStation; Agilent). Successful plasmid cleavage and PCR amplification produced bands at the ∼180 bp size and were sent for NGS sequencing as previously described3 ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Metabolites from the TCA cycle and glycolysis were detected using the 1260 Infinity LC System (Agilent) coupled to the QTRAP6500+ (ABSciex ...
-
bioRxiv - Cancer Biology 2023Quote: ... purified DNA from 27 mice with the Sureprint G3 mouse CGH 244K microarray kit (Agilent Technologies), as previously described11 ...
-
bioRxiv - Plant Biology 2023Quote: In planta samples from VIGS were measured with an Agilent Ultivo Triple Quadrupole LCMS (Agilent, USA) equipped with an Avantor® ACE® UltraCore™ SuperC18™ column (2.5 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 20µL from each elution were chromatographed using an XDB-C18 reversed phase HPLC analytical column (Agilent) and optimized mobile phase gradients.
-
bioRxiv - Bioengineering 2023Quote: ... Samples from the successive cultivations in microplate were analyzed using an HPLC Agilent 1200 Series (Agilent) equipped with an Aminex HPX-87H column coupled with a pre-column (Bio-Rad) ...
-
bioRxiv - Bioengineering 2022Quote: The targeted loci were amplified from extracted genomic DNA by PCR using Herculase II polymerase (Agilent). PCR amplicons were sequenced using primers ∼200 bp from the expected cut site ...
-
bioRxiv - Bioengineering 2022Quote: The targeted loci were amplified from extracted genomic DNA by PCR using Herculase II polymerase (Agilent). The PCR primers included Illumina sequencing handles as well as replicate-specific barcodes ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-K-RasG12V H95C and GFP-H-RasG12V Q95H mutants were designed and ordered from Agilent QuikChange Primer Design (Agilent ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μL of mixture from the HPLC vial was injected into HPLC (Agilent 1290 Infinity, USA), coupled with a triple-quadrupole mass spectrometer (Agilent 6470 series ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNAs were PCR amplified from the genomic DNA using Herculase II Fusion DNA Polymerase (Agilent Technologies) and the flanking primers (hGeCKO_F1 and hGeCKO_R1) ...
-
bioRxiv - Cell Biology 2023Quote: Non-codon optimised sequences were amplified from a human cDNA library (MegaMan human transcription library, Agilent). Mis18α ...
-
bioRxiv - Neuroscience 2024Quote: ... the quality was also examined by checking the RNA integrity number (RIN) using BioAnalyser from Agilent. The samples with RIN value ≥ 7 were subjected to the RNA library preparation.
-
bioRxiv - Molecular Biology 2024Quote: ... Horseradish peroxidase (HRP)-conjugated secondary antibodies were from Dako (cat # P026002-2 and cat # P021702-2) and detected using either SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: Cellular oxygen consumption rate (OCR) was measured using the extracellular flux analyzer XFe96 (from Seahorse Bioscience at the MOSBRI EU Infrastructure - HypACB facility at Sapienza University ...
-
bioRxiv - Cell Biology 2024Quote: ... A ∼260-bp enriched region was amplified from human genomic DNA using PfuTurbo Hotstart Polymerase (Stratagene) using primers listed in Table 2 and cloned into the pCR-Blunt ll-TOPO vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... The H548A mutation was introduced by site-directed mutagenesis (using Pfu Ultra II from Agilent Technologies). Expression was performed in E ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from mRNA-ribosome-bead complexes using the Absolutely RNA Nano Prep Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... the sections were rinsed in water with soap and mounted using DAKO mounting medium from Dako/Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: The capture Hi-C SureSelect library probes were designed over the genomic interval (mm9, chr1: 119,650,000–124,400,000) using the SureDesign online tool from Agilent.
-
bioRxiv - Bioengineering 2024Quote: Samples from in vitro and in vivo experiments were analyzed by a gas-chromatograph (8890, Agilent), equipped with an HP-1ms Ultra I column (19091S-733UI ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted from purified B cells using the Absolutely Total RNA Purification Kit (Agilent Technologies), as per manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were amplified from genomic DNA samples using the Herculase II Fusion DNA polymerase (Agilent Technologies) in two PCR steps as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... RINe numbers ranging from 7.8-10 were determined by TapeStation 4150 RNA ScreenTape Analysis (Agilent Technologies) before sending RNA to UC Davis DNA Technologies and Expression Analysis Core Laboratory for poly-A strand specific library preparation to obtain 60 million paired end read pairs by NovaSeq S4 (PE150 ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of amplified cDNA from each condition was analyzed using a 4200 Tapestation System (Agilent) prior to sequencing to confirm sample quality and a concentration of at least 1000 pg / µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were extracted from the Wave software (Agilent) and all time points were normalized to the first measurement ...
-
bioRxiv - Cell Biology 2020Quote: ... by electron capture negative ionization (ECNI) equipped with a DB-5MS column (40m × 0.180mm with 0.18µm film thickness) from Agilent. Hydrogen was used as carrier gas and injection port temperature were set at 300°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated with horseradish peroxidase-linked secondary antibody from the Envision Kit (Dako, K-5007) for 1 hour (100 µl/section ...
-
bioRxiv - Developmental Biology 2020Quote: ... CDB0573K: http://www2.clst.riken.jp/arg/mutant%20mice%20list.html) was constructed from a 129SVJ genomic clone (STRATAGENE, CA). Exon 1 of the Cnot9 locus was targeted and replaced by LacZ and neomycin resistance gene by electroporating TT2 ES cells (Yagi et al. ...
-
bioRxiv - Pathology 2020Quote: ... the purity and integrity of total RNA samples isolated from HCAEC was assessed using a Bioanalyser (Agilent) and high-quality samples from 4 HCAEC donors were used to prepare RNA-seq libraries that were sequenced on an Illumina HiSeq platform yielding 20 million reads per sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA was isolated from human normal and tumor tissues according to manufacture protocol (Agilent Cat#400800), and the quantity and quality were confirmed by NanoDrop 2000C spectrophotometer ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Synthetic Biology 2021Quote: Scanning mutant libraries were constructed using saturation mutagenesis using the QuikChange HT Protein Engineering System from Agilent following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Peaks from FID signal were integrated manually with Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA). Volatile emissions (ng1 100gFW-1 h-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Detection of peroxidase activity in the F4 and CD3 slides was detected with AEC + substrate from Dako En Vision+ System-HRP and ImmPACT® AEC Substrate ...
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The λ-EG10 phage were packaged in vitro from genomic DNA using Transpack packaging extract (Agilent Technologies). The λ-EG10 phage were then transfected into Escherichia coli YG6020 expressing Cre-recombinase ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the quality of the RNA from cells and EVs was assessed with an Agilent 2100 Bioanalyzer (Agilent), according to the manufacturer’s protocol (RNA 6000 Pico Kit).
-
bioRxiv - Cell Biology 2022Quote: ... Radioactive probes were synthesized from gel-purified templates using a Prime-it RmT Random Labeling Kit (Agilent) and alpha-32P-dCTP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from near-confluent 6 cm dishes using the Absolutely RNA Miniprep kit (Agilent) including an on-column DNase treatment step according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... we calibrated the ion mobility dimension linearly using at least two out of three ions from Agilent ESI LC/MS tuning mix (m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression data from fresh tumor tissue run by 44K Agilent Cy3/Cy5 2-color microarrays (Agilent) were available ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA fragments of ~400 bp were purified from each library and confirmed for quality by Bioanalyzer (Agilent). DNA-Seq libraries were prepared using the kit TruSeq DNA PCR-Free (Illumina) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from the leaf tissue using the Plant RNA Isolation Mini Kit Protocol (Agilent Technologies). RNA quality and concentration was measured using a NanoDropTM Lite Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... slides were incubated with goat anti-mouse HRP secondary antibody (“Visualization Reagent HRP” from SK006, Dako, Spain) for 30 min and visualized using the PD-L1 IHC 22C3 pharmDx (SK006 ...
-
bioRxiv - Molecular Biology 2022Quote: Chromatographic analyses were performed with a gas chromatography-mass spectrometry system (GC-MS) 7980A-5975C from Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... The drug-to-antibody ratio (DAR) is estimated from area integration using the OpenLab CDS software (Agilent).