Labshake search
Citations for Agilent :
8151 - 8200 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibody against Ki-67 (dilution 1:50; Code No. M7249, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... α (1–2,3,4,6) fucosidase and Sialidase A (all enzymes were purchased from Glyko/ProZyme, Inc.) in 100 mM ammonium acetated buffer (pH = 5.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated for 1 h at 37 °C with blocking buffer (Agilent Technologies, Waldbronn, Germany). Afterwards ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 1:4000 dilution of anti-mouse HRP-conjugated secondary antibody into blocking milk (DAKO) was applied to the membrane for 1h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubation with polyclonal goat anti-rabbit IgG/HRP antibody (1:1000; DAKO Cytomation) for 90 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or a DB-VRX capillary column (20 m, 0.18 mm ID, 1 μm film; Agilent); (ii ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse and/or rabbit IgG (1:1000, 1μg/mL, diluted in antibody diluent, Agilent Technologies) served as negative control ...
-
bioRxiv - Zoology 2023Quote: ... 1 µL of the derivatized samples were analyzed using a 7890B GC System (Agilent Technologies), and 5973 Network Mass Selective Detector (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... horse-radish peroxidase (HRP) conjugated secondary antibodies were used in 1:2500 (anti-rabbit, DAKO) or in 1:10.000 (anti-mouse ...
-
Cell cycle plasticity underlies fractional resistance to palbociclib in ER+/HER2- breast tumor cellsbioRxiv - Cancer Biology 2023Quote: ... Ki-67 was scored according to the Ki-67 IHC MIB-1 pharmDx (Dako Omnis) Interpretation Manual for Breast Carcinoma ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Biochemistry 2023Quote: ... The TEV eluates were incubated for 1 h with prewashed calmodulin sepharose beads (Agilent Technologies) and washed with lysis buffer containing 2 mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl of each sample was run on a 2100 Bioanalyzer (Agilent Technologies, CA, USA) with an Agilent DNA 1000 chip (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA concentration and integrity were determined using 1 µl in 4150 TapeStation System (Agilent). The rest of the sample was immediately frozen at -80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Staining of the brains was performed in groups consisting of GFAP (DAKO rabbit 1:500) and tomato lectin (Vector Labs mouse 1:250) ...
-
bioRxiv - Plant Biology 2023Quote: ... allowing a sub-sample (∼1 μg) into the pyrolizer of the GC/MS apparatus (Agilent, 7890A/5975C ...
-
bioRxiv - Genomics 2022Quote: ... Nucleosome footprints (1:10 dilution) were visualized by Tapestation using High sensitivity D1000 ScreenTape (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were stained with mouse monoclonal anti-CKAE1/AE3 antibody (Dako, M3515, 1:200 dilution), guinea pig polyclonal anti-doublecortin antibody (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... A horseradish peroxidase-conjugated polyclonal Goat Anti-Rabbit antibody (50µl, 1:2000; P0448, Dako; RRID:AB_2617138) was added in each well for 1.5 hours at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... an astrocytic marker (1:100, clone 6F2, Dako/Agilent, cat#M0761, Santa Clara, CA, USA), and MAP2 ...
-
bioRxiv - Plant Biology 2023Quote: ... or 1:1000 in nanopure water) were filtered through a 0.2 mm syringe filter (Agilent Captiva Econo Filter ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...
-
bioRxiv - Cell Biology 2024Quote: ... PAECs were immunolabelled using primary mouse monoclonal antibodies against CD31 (1:25; clone JC70A; Dako) and vWF (1:50 ...
-
bioRxiv - Physiology 2024Quote: ... Organoids were stained with the anti-lysozyme antibody for imaging diluted 1:1000 (Dako, #A0099) and visualized with goat antirabbit Alexa fluor 568 (Invitrogen #A-11036) ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (astrocytic marker, 1:100, clone 6F2, Dako/Agilent, cat#M0761, Santa Clara, CA, USA), vimentin (1:100 ...
-
bioRxiv - Microbiology 2024Quote: RNA quality and integrity was inspected in 1% agarose gels and a 2100 Bioanalyzer (Agilent). rRNA depletion ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Rapsyn-FLAG and rapsyn-Venus1 E162K mutants were generated by site-directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The quality and quantity of extracted RNA were measured by on-chip electrophoresis utilizing the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). Samples exhibited 1.9≤A260/A280◻≤◻2.2 ...
-
bioRxiv - Microbiology 2019Quote: ... Complementation of ΔfimB mutants were performed by cloning the promoter and encoding regions of the parental fimB genes into pSC-A-amp/kan (Table S4) by using the StrataClone PCR Cloning Kit (Agilent Technologies, Massy, France). The recombinant plasmid was then electroporated into competent strains S250ΔfimB: ...
-
bioRxiv - Neuroscience 2021Quote: ... Biotin-labeled amplified RNA (aRNA) size distribution and quantity was analyzed with the Agilent 2100 Bioanalyser using the RNA 6000 Nano LabChip kit (Agilent Technologies, Boeblingen, Germany). Samples with lower size compressed RNA products were discarded ...
-
bioRxiv - Molecular Biology 2020Quote: ... All site-directed mutagenesis reactions were performed by following the instructions in the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene, CA). Primers used for PCR and site-directed mutagenesis reactions are indicated in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The integrity of the synthesized RNAs was assessed using Agilent RNA 6000 Nano Kit with Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), these newly synthesized sgRNA constructs will be referred to as RP Loop sgRNA (RP-loop sgRNA ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... cDNAs were then used for library preparation and the quality of the final libraries assessed on the Agilent Bioanalyzer with DNA 1000 kit (Agilent, Cat# 5067-1504). The libraries were sequenced with Illumina Nova-sequencer with a depth of 300-400 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The quality and concentration of the extracted RNA was measured with the Agilent RNA 6000 nano kit (Cat-No: 5067-1511, Agilent, Santa Clara, CA) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the RNA integrity and concentration were assessed using the RNA Nano 6000 Assay Kit for the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Then ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA integrity and 28s/18s ratio were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cell Biology 2020Quote: pSecTagNC + ΔEGF_mN1 W1758A and pSecTagNC + ΔEGF_mN1 R1994A: these plasmids were generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pSecTagNC + ΔEGF_mN1 as a template and primers ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3 + mNICD R1994A: this plasmid was generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pcDNA3 + mNICD as a template and the primer A2026VmutF.
-
bioRxiv - Biochemistry 2019Quote: ... the G6b-B mutant with mutation in the potential heparin binding site (hG6b-B K54D/K58D/R60E/R61E referred to as hG6b-B-mut) was generated with the Quick Change Site-directed mutagenesis kit (Agilent Technologies, Stockport, UK).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The quality of RNA samples was analyzed using the RNA 6000 Pico Kit running on the 2100 BioAnalyzer (Agilent Santa Clara, California, US). Total RNA was diluted in a final volume of 50 μL for a total input of 1 μg ...
-
bioRxiv - Biophysics 2019Quote: ... We have demonstrated that attachment of the fluorescent proteins at these sites does not interfere with SERCA activity or PLB inhibition.25,26 PLB cDNA mutations were introduced using the QuikChange mutagenesis kit (Agilent Technologies, Santa Clara, CA), and all expression plasmids were sequenced for confirmation.
-
bioRxiv - Biochemistry 2019Quote: The eGFP-K17E construct for the mammalian expression of the SERF1a single-point mutant eGFP-K17E was generated by site-directed mutagenesis according to the QuickChange II mutagenesis kit manual (Agilent, Santa Clara, CA), using pEGFP/SERF1a (Tab ...
-
bioRxiv - Genomics 2020Quote: ... Chromium Genome Reagents Kit Version 2 User Guide) and size and concentration determined using an Agilent 2100 Bioanalyzer DNA 1000 chip (Agilent Technologies, CA, USA). Libraries were then sequenced on an Illumina NovaSeq 6000 System following the manufacturer’s protocols (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 100 nucleotides) was verified by fluorescent capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 pico kit, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... The concentration and quality of the RNA was determined by an Agilent 2100 Bioanalyzer with the Agilent RNA 6000 Pico Kit (Agilent Technologies, #5067-1513). The oligonucleotides used for the NGS were tabulated (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was eluted into 10 μL of nuclease free water and analyzed on Agilent 2100 Bioanalyzer using the RNA 6000 Pico kit (Agilent, catalog #5067-1513). For protein analysis ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...