Labshake search
Citations for Agilent :
751 - 800 of 993 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... incubated with DAPI (1:10’000) to label nuclei for 10 min and mounted using Fluorescence mounting medium (Dako, S3023). Fluorescent images were recorded with a Leica SP5 Confocal Microscope.
-
bioRxiv - Cell Biology 2021Quote: ... FACS sorted MPs were plated on XF96 cell culture microplates coated with 10% Matrigel in warm assay medium (Agilent), the cell culture plate was centrifuged with 200 g for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Molecular Biology 2021Quote: ... In TTBS rinsed slides were blocked for 10 min at room temperature using DAKO peroxidase blocking solution (#S200230, Dako), washed again in TTBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The desalted large peptide mixture was separated by a home-packed PLRP column (PLRP-S, 200 mm length x 500 μm i.d., 10 μm particle size, 1,000 Å pore size, Agilent) in a 63-min gradient from 10% to 90% mobile phase B (mobile phase A ...
-
bioRxiv - Bioengineering 2020Quote: ... VO2max = 1.04×10−16 mol/s/cell was measured for hiPSC-Heps using the Seahorse XF24 cellular respirometer (Agilent) (see ...
-
bioRxiv - Immunology 2021Quote: ... for 10 minutes at 37°C for F4/80 or blocked with a protein block (catalog number x0909, Dako) for 10 minutes followed by an Fc block (catalog number 553142 ...
-
bioRxiv - Biochemistry 2022Quote: ... The gas chromatograph was equipped with a DB-5 ms column (30 m × 0.25 mm, film thickness 0.25 μm; including 10 m DuraGuard column, Agilent Technologies) and a GC inlet liner (ultra inert ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were washed with PBS 1X for 10 mins and coverslipped with Dako fluorescence mounting medium (Dako North America).
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and equipped with a VF-5ms column (30 m × 0.25 mm × 0.25 μm, with 10 m EZ-guard column, J&W Agilent Technologies). For the analysis of CHCs ...
-
bioRxiv - Genomics 2020Quote: ... The coverslips were incubated with 10 μL mixture of a custom probe set targeting a selected DNA locus (Agilent) and SureFISH Hybridization Buffer (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Genetics 2020Quote: ... We determined efficiency of each reaction using the equation Efficiency = −1+10(−1/slope of standard curve) (Agilent Genomics). We additionally calculated ratios of transcript abundance to determine expression levels of one gene relative to another gene and to account for any differences in underlying mRNA levels among individuals ...
-
bioRxiv - Biochemistry 2021Quote: A serum volume of 10 µL was diluted ten times with load/wash buffer solution (Agilent Cat.#: 5185-5987). Each sample was filtered through a 0.22-μm spin filter (Agilent Cat.# ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the assay medium was prepared by supplementing Seahorse XF Base medium (pH 7.4) with a specific combination of 10 mM glucose (100X stock, Agilent), 1 mM pyruvate (100X stock ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...
-
bioRxiv - Microbiology 2022Quote: ... We then amplified 3 µL of cDNA (10 ng/µL) in Power SYBR (Thermo) with 1.6 µM primers using the AriaMx real-time PCR system (Agilent) in a volume of 12 µL ...
-
bioRxiv - Microbiology 2022Quote: ... contained a fused-silica fibre of 80μm x 10 mm coated with a layer of divinylbenzene–carboxen–polydimethylsiloxane (DVB/CWR/PDMS) (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... the buffer was exchanged into basic PBS (pH 8.0) with 0.1 % Tween-20 for a 2 h conjugation with 10 µM streptavidin (Prozyme, SA10) and 10 µM fluorescent dye (Lissamine Rhodamine B ethylenediamine ...
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... The CDKN1B Serine 10 to alanine mutant reporter was cloned using the Quikchange II site-directed mutagenesis kit (Agilent).
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent] ...
-
bioRxiv - Immunology 2023Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8-10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The protein (10 μL) was loaded by an LC system (Agilent 1290 Infinity II, Agilent Technologies, Santa Clara, CA) on a HPLC column (PLRP-S 1000 Å ...
-
bioRxiv - Physiology 2024Quote: ... Secreted protein in cell culture media was enriched using StrataClean Resin (Agilent, 10 µl per 5 ml of media) as previously described37 ...
-
bioRxiv - Bioengineering 2024Quote: ... A 10% solution of mTG in PBS was prepared and filtered through a 0.45 μm syringe filter (Agilent Technologies). The final concentration of mTG was 10 U/g (enzyme/gelatin) ...
-
bioRxiv - Microbiology 2024Quote: ... expression of reference genes was determined from 10-fold diluted cDNAs using a Stratagene Mx3005P qPCR system (Agilent Technologies) with QuantiTect SYBR Green RT-PCR Kit (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Oxygen consumption rates (OCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... We characterized a 1/10 dilution of both spikes using the TapeStation RNA HS kit (Agilent Technologies, CA, USA) and compared the true size distribution to the theoretical one (as calculated using the manufacturer’s molarity and sequence files).
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were deparaffinized by incubation at 60°C for 10 min and then incubated with PT-Link (Dako, Agilent) for 20 min at 95°C at pH 6.0 to detect TFEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were deparaffinized by incubation at 60°C for 10 min and then incubated with PT-Link (Dako, Agilent) for 20 min at 95°C at pH 6.0 to detect TFEB ...
-
bioRxiv - Plant Biology 2020Quote: ... and 10 µl samples injected into an Agilent Technologies 6420 Triple Quad Liquid Chromatography-Tandem Mass Spectrometry instrument (Agilent, USA). A Zorbax Extend-C18 column 3.0×150mm (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Forty reaction cycles of 10 s at 95 and 30 s at 58 °C were carried out on a Multiplex 3005 Plus (Stratagene/Agilent). The amplicon coordinates relative to the 47S rRNA initiation site (BK000964v3 ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: ... AChE and BTX were separated from other impurities by a size-exclusion column (Superdex 200 increase 10/300 GL column, GE Health) via HPLC (Infinity 1260, Agilent). The elution solution was 0.15 M phosphate buffer with NaCl concentration of 500 mM ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: ... Misfolded DNA scaffolds were removed by a size-exclusion column (Superdex 200 increase 10/300 GL column, GE Health) via HPLC (Infinity 1260, Agilent) using phosphate buffer (500 mM NaCl ...
-
bioRxiv - Plant Biology 2020Quote: ... except approximately 10 seedlings were used per RNA sample and analysis was performed using an MXPro 3005 real time PCR system (Agilent) with 5x HOT FIREPol EvaGreen qPCR mastermix (Solis Biodyne) ...
-
bioRxiv - Microbiology 2021Quote: Qualitative and quantitative measurements of viral load were determined by quantitative RT-PCR,10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times 10 min in Tris-Triton Solution and mounted on gelatin-coated slides using Fluorescence Mounting Medium (Dako). Z-stack images (4 optical sections ...