Labshake search
Citations for Agilent :
751 - 800 of 911 citations for IL 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Genomics 2021Quote: Exome capture was carried out for six cell lines and 39 mixtures using SureSelect Human All Exon V6 (Agilent Technologies, Inc., CA, USA). To minimize duplicate reads in ultra-deep sequencing ...
-
bioRxiv - Cell Biology 2019Quote: One-color microarray-based gene expression analysis was performed using a SurePrint G3 Human Gene Expression v3 8×60K Microarray Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene, La Jolla, CA). Quickchange II mutagenic primer sets were the following ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Physiology 2021Quote: Oxygen consumption was measured at 37°C from isolated mouse and human islets after overnight recovery using a Seahorse XF24 analyzer (Agilent, Santa Clara, CA). Islets were seeded at a density of 75 islets/well ...
-
bioRxiv - Neuroscience 2021Quote: The exome sequences were enriched from 1.0 μg genomic DNA using an Agilent liquid capture system (Agilent Sure Select Human All Exon V5). First ...
-
bioRxiv - Cell Biology 2019Quote: ... KLF4 and C-MYC open reading frames under the control of the human elongation factor-1α (EF-1α) promoter in the presence of 1.2% GeneJammer (a polyamine-based transfection reagent; Stratagene, La Jolla, CA, USA). Cells were maintained in mTeSR™1 (STEMCELL Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... The reaction products for the total RNA of the human cell line KMM-1 were analysed by microfluidics-based automated electrophoresis with the Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were resuspended in 100 µl of 0.5% BSA in PBS and incubated with mouse anti-human CD31 (Agilent Dako, M0823, clone JC70A) antibody-coated magnetic beads (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Overexpjression of MTf was accomplished by stably transfecting SK-MEL-28 cells with human MTf cDNA or with the empty pCMV-Script® (Stratagene, CA, USA) vector alone14 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The exome region of the whole genome libraries was enriched with the Agilent SureSelectXT Human All Exon Kit V6 (Agilent; Santa Clara, CA) and sequenced on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... We performed exome sequencing in the child with diabetes and his consanguineous parents and sibling using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb) and next-generation sequencing (Hiseq ...
-
bioRxiv - Cell Biology 2024Quote: Hybridization of samples was conducted on Agilent Whole Human Genome 4×44-k 60-mer oligonucleotide arrays (G4112F, Agilent Technologies, Santa Clara, CA), using 150ng of total RNA as template/sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Cancer Biology 2024Quote: ... WES libraries were prepared and captured using an Agilent SureSelect Human All Exon kit (Catalog No. 5191-5735, Agilent Technologies, Santa Clara, CA). The DNA library ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Immunology 2019Quote: ... RP1-5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ and RPI1-5’-CAA GCA GAA GAC GGC ATA CGA GAT CGT GAT GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ and the purified library was quantified with 4200 TapeStation (Agilent Technologies) and paired-end sequenced on a Nextseq 500 V2 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... The PAM sequences in the c(3)G gene were mutated using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology). The bases changed are in bold above ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted cells by the centrifugation for 3 min at 300 rcf are stained with FITC-conjugated anti-lysozyme antibody (Dako, F0372) and APC-conjugated anti-CD24 antibody (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: Measurements in both settings were performed in 3 min mix and 3 min measure cycles at 37 °C in six replicates per condition on a Seahorse XFe96 Analyzer (Agilent Technologies). OCR and ECAR were depicted as pmol/min and mpH/min ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Immunology 2021Quote: ... HES5 and GATA6 genes were made for 3 replicates using the Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technologies) and analyzed on a CFX Opus Real-Time PCR system (BioRad ...