Labshake search
Citations for Agilent :
751 - 800 of 4607 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... transferred on glass slides and mounted for visualization with anti-fading mounting medium (Agilent #S302380-2). Confocal images were acquired using a Nikon Eclipse C1si laser-scanning microscope equipped with a 20x (NA 0.75 ...
-
bioRxiv - Biochemistry 2021Quote: ... in 2 mL headspace vials and analysed on an HPLC instrument (Agilent Technologies, 1260 Infinity II); peaks were identified using pure standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without LPS plus ATP ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies against EGFR (2-18C9) and Ki-67 (M1B1) were obtained from Agilent (Santa Clara, CA). The anti-MCT1 antibody was obtained from Merck (Rockville ...
-
bioRxiv - Genomics 2022Quote: ... Sections were incubated for 5min with hematoxylin (SigmaAldrich) followed by 2 min in bluing buffer (DAKO) and 10s in eosin Y (0.45M ...
-
bioRxiv - Microbiology 2022Quote: ... Growth measurements were obtained in a 96-well plate using an Epoch 2 Microplate Spectrophotometer (Agilent) inside of an anaerobic chamber ...
-
bioRxiv - Neuroscience 2022Quote: ... and were subsequently incubated with goat anti-rabbit labelled polymer EnVision+ Single Reagent (Dako, K400311-2) for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako ...
-
bioRxiv - Neuroscience 2023Quote: ... the labelled antibodies were developed with a Dako Liquid DAB+ substrate chromogen system (Dako; GV82511-2).
-
bioRxiv - Cell Biology 2023Quote: ... Optical density (OD) was measured with a BioTek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA) for at least 15 min to obtain blank values for each well at the target temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Slides were then mounted with Dako fluorescence mounting media (S302380-2, Agilent Technologies, Santa Clara, US). The primary antibodies and respective concentrations used in this study are the following ...
-
bioRxiv - Neuroscience 2023Quote: ... we mounted the cultures on glass slides with DAKO anti-fading mounting medium (#S302380 − 2, Agilent) for confocal microscope imaging.
-
bioRxiv - Bioengineering 2022Quote: ... the sections were buffered in DAKO wash buffer (Cat #K800721-2, Agilent, Santa Clara, CA, USA) before incubating in primary antibody diluted in DAKO antibody diluent (Cat# S080983-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The coverslips were then mounted on slides using DAKO Faramount Aqueous Mounting Medium (Agilent, #S302580-2). The slides were kept for 24h to allow the mounting media to cure before use.
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... we mounted the cultures on glass slides with DAKO anti-fading mounting medium (#S302380 − 2, Agilent) for confocal microscope imaging.
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated 10 minutes in H2O2 solution (S202386-2, Agilent Technologies, Santa Clara, CA, USA) to quench endogenous peroxidases ...
-
bioRxiv - Cancer Biology 2024Quote: ... gaskets were removed and slides were mounted onto coverslips using Fluorescence Mounting Medium (S302380-2, Agilent). Images were acquired using a Zeiss Axio Scope.A1 fluorescence microscope with 40× and 100x magnifications and further analyzed with ImageJ ...
-
bioRxiv - Plant Biology 2019Quote: ... 1/4 pear sections from 4 fruits per replicate) were injected into a HP 5890A gas chromatograph (Agilent, Avondale, PA, USA) with a flame ionization detector (FID ...
-
bioRxiv - Developmental Biology 2020Quote: ... antibody staining was carried out using an anti-RFP antibody for 1h detected with EnVision HRP anti-rabbit secondary (Agilent) followed by incubation with Tyramide-conjugated Opal 570 (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lifted and seeded at 2×104 cells/well in XFe96 Cell Culture Microplate (Agilent Technologies) in 80 μl of fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were stained with 3,3’-diaminobenzidine solution (DAB; Liquid DAB+ Substrate Chromogen System, K346889-2, Dako), counterstained with hematoxylin ...
-
bioRxiv - Cancer Biology 2019Quote: ... slides were washed twice in deionized water and then counterstained in hematoxylin (Agilent DAKO, catalog #K800821-2) for 5 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... slides were washed twice in deionized water and then counterstained in hematoxylin (Agilent DAKO, catalog #K800821-2) for 5 minutes ...
-
bioRxiv - Immunology 2019Quote: ... The Dynabeads were then stained with F(ab’)2 FITC-Conjugated Goat Anti-Mouse Immunoglobulins (Dako, F0479) at 1:50 dilution for 1 hr ...
-
bioRxiv - Immunology 2021Quote: ... followed by EnVision FLEX DAB+ Chromogen in Substrate buffer (Agilent; anti-SARS-CoV-2, -CD8, -CD45R, -Iba1) for 10 min at RT or the DAB-Map-Kit (Ventana ...
-
bioRxiv - Microbiology 2020Quote: ... Optical densities were recorded at 600 nm every hour in Epoch 2 Microplate Reader (Biotek, Agilent Technologies).