Labshake search
Citations for Agilent :
751 - 800 of 870 citations for 6 Chloro 5 methylisatin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Cancer Biology 2024Quote: Adherent cell growth assays were performed via label free live cell imaging using the Cytation 5 Imaging Multi-Mode reader with attached BioSpa (Agilent BioTek). For 72 hr growth analysis cells were plated at ∼500 cells/well while for 144 hr growth analysis cells were plated at ∼100 cells/well ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed using a QuantStudio™ 5 Real-Time PCR System with Brilliant II low ROX Sybr Green (Agilent). Reactions were performed with at least 2 technical replicates and 3 biological replicates were performed for each experiment ...
-
bioRxiv - Cell Biology 2024Quote: ... Following the 24 min gradient the analytical column was backflushed for 6 min with 99% acetonitrile at a 0.8 ml/min flow rate followed by a 5 min re-equilibration step (MassHunter Metabolomics dMRM Database and Method, Agilent Technologies). Data analysis was performed with MassHunter Quantitative Analysis (v ...
-
bioRxiv - Biophysics 2024Quote: ... The plate was gently shaken to mix the well contents and the absorbance at 595nm was measured with a Biotek Cytation 5 Microplate Reader (Agilent, USA). The absorbances of the diluted samples were used to form dilution curves and the slopes of the linear regions of each curve were compared to determine the necessary dilution factors for each lysate that would allow the curves to overlap ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Bioengineering 2024Quote: ... The pellets from centrifugation were dried under vacuum and re-dissolved using 5% acetic acid aqueous solution for purification by HPLC (1260 Infinity, Agilent Technologies) equipped with a C8 column (Zorbax 300SB-C8 ...
-
bioRxiv - Biochemistry 2024Quote: ... Tryptic peptides were separated with a microfluidic reversed-phase HPLC chip (ZORBAX 300SB-C18; particle size, 5 μm; inner diameter, 75 μm; and length, 43 mm; Agilent Technologies). Samples were loaded using 0.1% formic acid and 5% acetonitrile in water as a mobile phase at flow rate of 4 μl/min ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the manufacturer’s instructions with the following changes: RNA was fragmented 5’ and the protocols were automated using an Agilent NGS workstation (Agilent Technologies) with purification steps described by Lundin et al ...
-
bioRxiv - Neuroscience 2019Quote: ... Paraffin embedded human brain sections were de-waxed for antigen retrieval with 90% formic acid (5 min) followed by citrate boiling (45min, 98°C DAKO Citrate Buffer, DAKO PT Link). Sections were then blocked using 0.1% (w/v ...
-
bioRxiv - Bioengineering 2021Quote: ... The samples were separated on an Eclipse XDB-C18 analytical column (250 mm × 4.6 mm, 5 µm, Agilent, Santa Clara, CA, USA). The mobile phase solvents were composed of 1% acetic acid in water (solvent A ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Plant Biology 2021Quote: ... Chromatographic separation was achieved using a DB-5 column (inner diameter, 0.25 mm × 30 m and film thickness, 1.00 μm, Agilent Technologies, Wilmingston, NC, USA). The carrier gas was helium at a flow rate of 1.1 ml min−1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... All sections were washed once with PBS for 5 min and mounted with Fluorescence Mounting Medium (Dako, Agilent, Santa Clara, California, USA). Images were acquired on a fluorescent slide scanner (Zeiss Axioscan ...
-
bioRxiv - Developmental Biology 2021Quote: ... All sections were washed once with PBS for 5 min and mounted with Fluorescence Mounting Medium (Dako, Agilent, Santa Clara, California, USA). Images were acquired on a fluorescent slide scanner (Zeiss Axioscan ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were washed twice with PBS + 0.5% Triton X-100 and then rinsed one time with PBS before mounting with DAKO Fluorescence Mounting Medium (S3023; Dako NA Inc.). Images were analyzed with a Nikon Eclipse Ti fluorescence microscope with a Plan Fluor 40 Å∼ /1.30 Oil DIC N2 objective ...
-
bioRxiv - Physiology 2019Quote: ... Endogenous peroxidase was blocked using the EnVision FLEX Peroxidase-Blocking kit followed by two washes for 5 min each (Dako wash buffer). Sections were incubated for 60 min with a rabbit anti-KCNN4 primary antibody (AV35098 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The original eGFP-C2-DEF6 plasmid (5) was used to generate the mutant DEF6 proteins by mutagenesis PCR (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent Technologies, #210516). All mutations were verified by sequence analysis (see Suppl ...
-
bioRxiv - Microbiology 2020Quote: Each ELV and MV preparation were reconstituted in 10 μl of 5% formic acid and injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies, USA). The samples were then desalted for 5 min at 30 μl/min using 0.1% formic acid and the peptides were then eluted onto an analytical nano-HPLC column (150 mm × 75 μm 300SBC18 ...
-
bioRxiv - Zoology 2020Quote: ... 5890 Series II gas chromatograph equipped with an HP-5 column (30 m×0.32 mm ID× 0.25 mm) (Agilent, Palo Alto, CA, USA). The oven temperature was held at 40 °C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... column protected with an ZORBAX RRHD Eclipse Plus C18 5 × 2.1 mm ID (1.8 μm) guard column (Agilent Technologies, Foster City, CA). The mobile phase consisted of water and methanol (both added 0.1% formic acid ...
-
bioRxiv - Genomics 2020Quote: Dried peptides were separated by high pH reverse phased liquid chromatography on an Agilent 1100 HPLC system using a Zorbax Eclipse column (2.1 × 150 mm, 5 um) (Agilent Technologies, Palo Alto). Peptides were eluted with a linear gradient of 20 mM ammonium formate pH 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membranes were washed thrice for 5 min in TBS-T and incubated with Horseradish peroxidase secondary antibodies (DAKO, Santa Clara, USA) for 1 hr at RT ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were separated on an Eclipse XDB-C18 analytical column (250 mm x 4.6 mm, 5 μm, Agilent, Santa Clara, CA, USA). The mobile phase solvents were composed of 1% acetic acid in water (solvent A ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 37°C for 1 hour followed by vehicle or TGF-β (5 ng/ml) and 3000 cells were seeded into Seahorse assay microplates (Agilent Technologies). After 24h of incubation ...
-
bioRxiv - Cell Biology 2022Quote: ... PSC27 was seeded at a density of 5 × 104 cells/ well in the XF24 cell culture microplate (Agilent Technologies, 04721 and Q01321) at a 37[5% CO2 incubator for overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Molecular Biology 2024Quote: ... then spectrometry readings were collected every 5 min for 1 h using a BioTek Epoch microplate spectrophotometer (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Neuroscience 2024Quote: OCR assay: Cells were washed and incubated for 1 hour with 180 μL assay medium [in mmol/L: 5 glucose (Agilent #103577-100), 1 pyruvate (Agilent #103578-100) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then washed in PBS 5 x 5 mins, then mounted with a cleaned glass coverslip (#1.5, 24 mm x 60 mm) in mounting media (Dako; Pathology Products, S3023).
-
bioRxiv - Molecular Biology 2023Quote: A fluorescent image of rehydrated brain tissue with a thickness of 275 μm stained with Amy tracker and placed on glass microscopic slides was acquired using the manual mode in a Cytation 5 multimode reader (Agilent Technologies, USA). Montage images were collected at 4x and 20x magnification ...
-
bioRxiv - Molecular Biology 2023Quote: ... column protected with an ZORBAX RRHD Eclipse Plus C18 5 x 2.1 mm ID (1.8 µm) guard column (Agilent Technologies, Foster City, CA). The mobile phase consisted of water and methanol (both added 0.1% formic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were counterstained with DAPI (1:1000 in 1X PBS) for 5 min and coverslipped with fluorescent mounting medium (#S3023, DAKO, Jena, Germany). Images were obtained using an Axioplan M2 fluorescent microscope (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: ... Pools were diluted to 5 ng/µL and quality and size are assessed using Agilent DNA High Sensitivity chip (Agilent Technologies, Inc.) on the Bioanalyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The dried labelled peptide plexed sample was then resuspended in 400uL of 1 M TEAB and fractionated using an Agilent 1100 HPLC system and high pH reversed phase chromatography on a Zorbax Eclipse XDB-C18 column (4.6 x 150mm, 5-micron) from Agilent (Santa Clara, CA). Sixty fractions were collected at 0.5 mL/min over 105 min using a gradient of 0-5% solvent B in 10 min ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Cancer Biology 2023Quote: ... Blocking with endogenous peroxidase was performed with Protein Block (Novocastra Laboratories) for 5 min and subsequent steps were performed in DAKO autostainer link 48 (Agilent Technologies, Inc.). Slides were counterstained in hematoxylin-eosin ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed four times for 5 min each in TBST and incubated with Polyclonal goat anti-mouse (P044701, Agilent, 1:2500) or anti-rabbit (P044801 ...
-
bioRxiv - Immunology 2023Quote: ... Bacteria were fixed with 0.5% formaldehyde at RT for 30 min and then wells were washed twice with a washer dispenser (BioTek EL406, Agilent Technologies, US) with PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... fibroblasts were seeded at 45 × 103 cells per well (5-10 replicates per cell line) in fibroblast growth media in a Seahorse XFe24 Microplate (Agilent, 100777-004) and incubated for 24 hours to allow cells to adhere ...