Labshake search
Citations for Agilent :
751 - 800 of 4754 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (S236784-2, DAKO, Carpinteria, CA, USA), for 20 min in a microwave oven ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... Coverslips were mounted using Glycergel (DAKO, C056330-2) preheated to 60°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution High pH (Agilent Cat#GV80411-2), 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution Low pH (Agilent Cat#GV80511-2), Retrieval Solution High pH (Agilent Cat#GV80411-2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako REAL Peroxidase-blocking reagent (Agilent S202386-2), bluing reagent (Leica ...
-
bioRxiv - Immunology 2024Quote: ... diluted in Antibody diluent solution (Dako, S080983-2) overnight at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (103579-100, Agilent Technologies) and 1 mM sodium pyruvate (103578-100 ...
-
bioRxiv - Immunology 2024Quote: ... or goat anti-rabbit IgG (Agilent, P044801-2), secondary antibodies diluted 1/1000 in 5% (w/v ...
-
bioRxiv - Genomics 2022Quote: ... the Dako Bluing Buffer (Agilent Technologies, CS70230-2) was removed from each well and then each well washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Genomics 2022Quote: ... 75µL of Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was added to each tissue section well ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM glutamine (Agilent, Santa Clara, CA). The plate was incubated in a 37°C non-CO2 incubator for 1h prior to measurement ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2% proteinase K (Dako Omnis) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine solution (cat 103579-100) (Agilent). Neuron cultures were transferred to a non-CO2 incubator for 1 hour prior to running the assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Vimentin primary antibody (Agilent, Cat#M072529-2) was diluted 1:75 in 2.5% horse serum ...
-
bioRxiv - Neuroscience 2024Quote: ... total tau (Agilent Technologies, A002401-2, CA, USA), PHF1 (kindly gift from late Dr ...
-
bioRxiv - Physiology 2024Quote: ... and 2 mM L-Glutamine (Agilent #103579-100), and incubated at 26°C in a CO2-free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted with mounting medium (S302380-2, Dako) on microscope slides.
-
bioRxiv - Neuroscience 2024Quote: ... or Dako EnVision Flex hemotoxylin (K800821-2, Dako). Slides were dehydrated in an ascending ethanol series and cleared in xylene before cover slipping with Cytoseal 60 (22-244-256 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM Glutamine (Agilent Technologies, 103579-100). HDLECs were maintained for 1 hour in a CO2-free incubator at 37 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... A high resolution gas chromatography capillary column 30m x 0.25 mm coated with 0.25 μm film thickness was used (DB-FFAP) for the volatile acids (Agilent Technologies) and a high resolution gas chromatography capillary column 30m x 0.25 mm coated with 0.50 μm film thickness was used (DB-FFAP ...
-
bioRxiv - Biochemistry 2021Quote: ... Selected residues were mutated to alanine or oppositely-charged amino acids by PfuUltra II Hotstart PCR Master Mix (Agilent). All mutated sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... Each reaction was quenched by 30 x dilution into 0.1% formic acid and loaded onto an electrospray ionisation time-of-flight (LC-MSD TOF) spectrometer (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... The codon at amino acid position 160 in HA (H3 numbering, Threonine) was modified via site-directed mutagenesis (Agilent) from the wild type (ACA ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions and deletions were introduced into pET28b vectors with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... Crude peptide was subsequently purified by reverse phase high-pressure liquid chromatography on a C18 semiprep column over an acetonitrile gradient with 0.1% trifluoroacetic acid and analyzed by liquid chromatography triple quadrupole mass spectrometry (Agilent).
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Systems Biology 2023Quote: ... the supernatant was diluted with mobile phase (10mM Ammonium acetate 0.03% formic acid) and filtered using a 0.45 µm 96-well microplate (polypropylene membrane, Cat. No. 200983-100, Agilent) by centrifugation for 30 minutes at 5,250 x g ...
-
bioRxiv - Pathology 2023Quote: Sugars and Organic acids were quantified in the RCJ using high-performance liquid chromatography (HPLC) (1200 series, Agilent Technologies) with a diode-array detector (DAD ...
-
bioRxiv - Developmental Biology 2023Quote: ... Periodic acid-Schiff (PAS) and hematoxylin and eosin (H&E) staining were performed using standard procedures (Dako, Glostrup, Denmark) for the assessment of normal structures.
-
bioRxiv - Microbiology 2024Quote: ... Cell free supernatants were acidified with formic acid (0.1% final concentration) and analysed by GC-FID using a DB-FFAP column (Agilent).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Amino acid deletions for ΔKPQ were generated by use of the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent, USA). PCR products were cloned into XL-10 Gold Ultracompetent cells ...
-
bioRxiv - Plant Biology 2024Quote: ... Separation of amino acid was done with a Zorbax Eclipse XDB-C18 column (50 × 4.6 mm, 1.8 μm, Agilent Technologies). The mobile phase comprised of solvent A (water ...
-
bioRxiv - Physiology 2024Quote: ... Peptides were reconstituted in 50 µL 15% ACN/0.1% acetic acid and analyzed on an 1290 Infinity II LC system (Agilent) coupled to QTRAP instrument (Sciex ...
-
bioRxiv - Cell Biology 2024Quote: ... All point mutations and amino acid deletions were incorporated into constructs using the QuikChange site-directed mutagenesis kit (Agilent). All constructs were expressed using either the pINDUCER20-C1-EGFP lentiviral vector (Crawley et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of each sample was injected in splitless and split 1:10 mode into a 6890N gas chromatograph (Agilent Technologies Inc. Santa Clara, CA) coupled to a Pegasus 4D TOF mass spectrometer (LECO ...
-
bioRxiv - Immunology 2022Quote: ... and a tyramide-barcode staining cycle performed for mouse anti-MUM1 primary antibody (1:100 dilution, clone MUM1p, Agilent Dako Products, catalog number GA64461-2). However ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).