Labshake search
Citations for Agilent :
701 - 750 of 2139 citations for Phospho Tyrosine Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:400 for two hours and then incubated for 30 minutes with Rabbit Envision HRP System reagent (Agilent, Santa Clara, CA). For vimentin staining ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-conjugated secondary antibodies (Dako) were used ...
-
bioRxiv - Pathology 2020Quote: ... HRP-conjugated secondary antibodies (Dako) and chemiluminescent detection was carried out using ECL Prime® (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2019Quote: ... HRP-conjugated secondary antibodies (Dako) were incubated for 1h at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... Envision system-HRP (DAKO K4007) in 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-anti-mouse (Dako, P0260), HRP-anti-rabbit (Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary HRP coupled antibody (Dako 1/1000 dilution in a buffer composed 5% low fat milk powder or 5% BSA in TBS and 0.1% Tween20 ...
-
bioRxiv - Neuroscience 2020Quote: ... or α-mouse-HRP (Dako) (1:10000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Streptavidin-HRP was from DAKO.
-
bioRxiv - Cancer Biology 2019Quote: ... and Streptavidin-HRP (P0397, Dako) at 1:500 dilution for 30 minutes at RT ...
-
bioRxiv - Physiology 2021Quote: ... EnVision+ System-HRP (K4011, Dako) was used as secondary antibody as supplied ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-coupled secondary antibodies (Dako) were used in a 1:1000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... LSAB2 System-HRP (#K0675, Dako) and Liquid DAB+ Substrate Chromogen System (#K3468 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated secondary antibody (Dako), diluted 1 ...
-
bioRxiv - Pathology 2023Quote: ... HRP-conjugated secondary antibodies (DAKO) were incubated for one hour at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... HRP-conjugated secondary antibodies (Dako) and chemiluminescent detection was carried out using ECL Prime® (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... HRP-coupled secondary antibodies (DAKO) and ECL system (PerkinElmer ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K4003) as required ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K4003) as required ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or HRP-labelled antibodies (DAKO) (P0447 ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... HRP-coupled secondary antibodies (Dako) were used in a 1:1000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin (polyclonal Z0622, dilution 1:250, Dako) and DAPI (Akoya Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... polyclonal anti-tau antibody (Dako, 1/500), monoclonal anti-alpha-synuclein (LB509 ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP polyclonal (1:1,000; DAKO, Glostrup, Denmark), GFAP monoclonal (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with polyclonal mouse (DAKO; P0447), or rabbit (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Physiology 2021Quote: ... Antibodies bound to PCPE-1 were then detected by incubation with a HRP-conjugated rabbit anti-goat antibody (P0449; Dako; 50 ng/ml). After washing ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were examined in a detergent insolubility assay adapted from Drisaldi et al.43 and the proteins in the supernatant and pellet were analyzed by Western blot using the anti-tau rabbit polyclonal antibody DAKO (Agilent Technologies Italy SpA, Milan, Italy) (1:10000 dilution) ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were washed once with the same buffer and incubated with FITC-conjugated polyclonal swine anti-rabbit immunoglobulin antibody from DAKO (dilution 1:40 in BP) for 1 hr at 4°C on ice with shaking ...
-
bioRxiv - Physiology 2020Quote: ... Positive cells were labeled by DAB chromogen (DAKO) for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Labeled DNA was diluted in hybridization buffer (Agilent) and hybridized to arrays for 24 h at 65°C ...
-
bioRxiv - Immunology 2022Quote: ... labeled iRBCs were mixed with 30ug PE (Agilent) prior to injection.
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Biochemistry 2021Quote: ... The CD22 point mutations from tyrosine to phenylalanine were introduced by site-directed mutagenesis according to the QuikChange method (Agilent, Santa Clara, USA).
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Immunology 2021Quote: ... polyclonal guinea pig anti-insulin (undiluted, IR002, Dako) for 20min ...
-
bioRxiv - Cell Biology 2019Quote: ... After treatment with peroxidase-linked antibody (Dako, polyclonal) for 1 hour ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cytokeratin (polyclonal Z0622, dilution 1:250, Dako). Panel 2 consisted of primary antibodies against CD3 (clone LN10 ...
-
bioRxiv - Physiology 2023Quote: ... or polyclonal anti-mouse (1∶2000, P0447, DAKO) in 5% dairy milk for 1 hour at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Dako-EnVision+System-HRP (K4002, Dako) was used for immunodetection ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-IgG-mouse-HRP (Dako, P0447) anti-IgG-Goat-HRP (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: ... Following HRP-linked secondary antibody (Dako) incubation for 1h at RT ...
-
bioRxiv - Immunology 2022Quote: ... Streptavidin HRP (P0397, Dako, 1:200)
-
bioRxiv - Immunology 2019Quote: ... Goat Anti-Mouse Immunoglobulin/HRP (Agilent) was used at a 1:1 dilution for 10 minutes and then washed with PBS-T ...
-
bioRxiv - Cancer Biology 2020Quote: ... EnVision FLEX HRP detection reagent (Dako) for secondary amplification and enzymatic conjugation ...
-
bioRxiv - Cancer Biology 2023Quote: ... HRP conjugated (Dako #P0448; 1:1000). Proteins were visualized using ECL Western Blotting detection reagent (Amersham #RPN2106 ...