Labshake search
Citations for Agilent :
701 - 750 of 2582 citations for 7 Chloro 5 methyl 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and 72°C for 20 s using AriaMx Real-Time PCR System (Agilent). All primers (Table S1 ...
-
bioRxiv - Biochemistry 2022Quote: ... and (iii) C-IDR (residues 445-632) via QuikChange Site-Directed Mutagenesis (Agilent) for protein expression ...
-
bioRxiv - Microbiology 2022Quote: ... equipped with 50 mm x 4.6 mm column (XDB C-18, Agilent Technologies). MS data were acquired from 50 to 1000 Da in profile mode and reference ions at m/z 371.1012 ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then incubated overnight at 4°C with anti-CD4 (Dako) in a 1:10 dilution ...
-
bioRxiv - Developmental Biology 2022Quote: ... brain sections were pretreated with target retrieval solution (DAKO, 20 min, 95°C) prior incubation with the following primary antibodies overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were next incubated overnight at 4°C with anti-PCNA antibody (DakoCytomation, clone PC10 ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were incubated for 30 min at 95°C in retrieval solution (Dako). Primary antibodies were incubated overnight at 4°C or 3 hours at room temperature ...
-
bioRxiv - Plant Biology 2024Quote: ... Zorbax Eclipse XDB-C 18 column (50 x 4.6 mm, 1.8 µm, Agilent) was used coupled with a triple Quadruple-trap MS/MS system (Sciex 6500+ ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluorescence of plasma samples was directly measured using a Take 3 Microvolume Plate (Agilent), measured using an Agilent Cytation 7 (Excitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times with 100 µL of XF Base Media (Seahorse Bioscience) containing 2 mM L-Glutamine ...
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Physiology 2023Quote: ... Plates were read according to manufacturer’s instructions using the Cytation 3 plate reader (Agilent) with Gen5 software (v2.04).
-
bioRxiv - Immunology 2023Quote: ... and rabbit polyclonal antibodies against CD-3 protein (Dako, Glostrup, Denmark; cat. no. A0452).
-
bioRxiv - Cancer Biology 2023Quote: ... Endogenous peroxidase activity was blocked with 3 % hydrogen peroxidase solution (Dako, S2023, CA, USA) for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or on a Poroshell 120 EC-C18 (Agilent, 3 x 150 mm, 2.7 µm) reversed phase column ...
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Plant Biology 2022Quote: ... derivatized overnight at 60 °C and analysed using a 30 m VF5 column (Agilent Technologies ...
-
bioRxiv - Genomics 2019Quote: ... The concentration of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies), and the Hi-C libraries were paired-end sequenced (HiSeq 2500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were imaged at 37 °C by using a Lionheart FX automated microscope (Agilent) with 20x and 60x objectives ...
-
bioRxiv - Pathology 2020Quote: ... Antigen retrieval was performed by incubation in Target Retrieval Solution (DAKO, 30min, 95°C). After blocking in 5% BSA in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Physiology 2020Quote: ... before being blunt-end cloned into pBluescript SKII (C) (Agilent Technologies, Stockport, Cheshire, UK) or Zero Blunt® Topo PCR (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... sections were probed with an anti-HSV antibody incubated overnight at 4°C (Dako), a donkey anti-rabbit IgG-HRP antibody (Jackson Immunoresearch ...
-
bioRxiv - Immunology 2020Quote: ... T cells were measured at 37°C using an Xfe96 extracellular analyzer (Seahorse Bioscience). Briefly ...