Labshake search
Citations for Agilent :
701 - 750 of 4747 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) was purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Microbiology 2024Quote: ... Sections for SARS-CoV-2 IHC were additionally blocked with 10% goat serum (X0907, DAKO) for 30 minutes at room temperature (RT) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a drop of DAKO fluorescence mounting medium (Agilent Ref S302380-2, Santa Clara, CA, USA) was placed on a glass slide ...
-
bioRxiv - Immunology 2024Quote: ... Deparaffinized tissue sections (2 μm) were incubated with Dako REAL peroxidase-blocking solution (Dako, K0672) to inactivate endogenous peroxidases and unspecific binding was blocked (PBS/1% BSA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2*105 CD8+T cells were seeded in a XFe96 microplates (cat#103793-100, Agilent). After treatment ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was done using 1x of Target Retrieval Solution pH9 (Agilent Dako, S236784-2) at 95-98°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was done using 1x of Target Retrieval Solution pH9 (Agilent Dako, S236784-2) at 95-98°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako, Santa Clara, 527 CA, United States) diluted 1:2000 in milk ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2024Quote: ... Assay medium consisted of XF Base Medium Minimal DMEM with phenol red (#103334-100, Agilent Technologies), 1 mM pyruvate ...
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without 20 ng/ml IL-4 for 6 or 24 h or ACs for 3 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Absorbance was measured at 564 nm with a Synergy 2 Multi-Detection Microplate Reader (Agilent Technologies) and normalized to a vehicle control ...
-
bioRxiv - Biochemistry 2022Quote: Anthocyanins were quantified using a UHPLC–DAD Agilent 1290 Infinity system (Agilent Technologies, USA; System 2). The UHPLC consisted of a diode-array (DAD ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA) for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µl of the solution was separated on a gas chromatograph (GC 7890A; Agilent Technologies) equipped with a Phenomenex ZB-35 (30m × 0.25mm × 0.25µm ...
-
bioRxiv - Neuroscience 2020Quote: ... transferred on glass slides and mounted for visualization with anti-fading mounting medium (Agilent #S302380-2). Confocal images were acquired using a Nikon Eclipse C1si laser-scanning microscope equipped with a 20x (NA 0.75 ...
-
bioRxiv - Biochemistry 2021Quote: ... in 2 mL headspace vials and analysed on an HPLC instrument (Agilent Technologies, 1260 Infinity II); peaks were identified using pure standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of the ligation product was transformed into bacteria using XL10-Gold Ultracompetent Cells (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Immunology 2021Quote: 2 × 105 BMDMs were plated into each well of Seahorse XF96 cell culture microplates (Agilent Technologies) and cultured overnight before treated with or without LPS plus ATP ...
-
bioRxiv - Neuroscience 2023Quote: ... the labelled antibodies were developed with a Dako Liquid DAB+ substrate chromogen system (Dako; GV82511-2).
-
bioRxiv - Cell Biology 2023Quote: ... Optical density (OD) was measured with a BioTek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA) for at least 15 min to obtain blank values for each well at the target temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Slides were then mounted with Dako fluorescence mounting media (S302380-2, Agilent Technologies, Santa Clara, US). The primary antibodies and respective concentrations used in this study are the following ...
-
bioRxiv - Cancer Biology 2024Quote: ... gaskets were removed and slides were mounted onto coverslips using Fluorescence Mounting Medium (S302380-2, Agilent). Images were acquired using a Zeiss Axio Scope.A1 fluorescence microscope with 40× and 100x magnifications and further analyzed with ImageJ ...
-
bioRxiv - Neuroscience 2022Quote: ... and were subsequently incubated with goat anti-rabbit labelled polymer EnVision+ Single Reagent (Dako, K400311-2) for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated 10 minutes in H2O2 solution (S202386-2, Agilent Technologies, Santa Clara, CA, USA) to quench endogenous peroxidases ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Genomics 2023Quote: ... then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, Cat# S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning disk confocal microscope (SpinSR10 ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies against EGFR (2-18C9) and Ki-67 (M1B1) were obtained from Agilent (Santa Clara, CA). The anti-MCT1 antibody was obtained from Merck (Rockville ...
-
bioRxiv - Genomics 2022Quote: ... Sections were incubated for 5min with hematoxylin (SigmaAldrich) followed by 2 min in bluing buffer (DAKO) and 10s in eosin Y (0.45M ...
-
bioRxiv - Microbiology 2022Quote: ... Growth measurements were obtained in a 96-well plate using an Epoch 2 Microplate Spectrophotometer (Agilent) inside of an anaerobic chamber ...
-
bioRxiv - Bioengineering 2022Quote: ... the sections were buffered in DAKO wash buffer (Cat #K800721-2, Agilent, Santa Clara, CA, USA) before incubating in primary antibody diluted in DAKO antibody diluent (Cat# S080983-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and anti-CD45 clone 2B11 + PD7/26 (Ready-to-use, Agilent Dako cat. no. GA75161-2). After washing away the primary antibodies ...