Labshake search
Citations for Agilent :
701 - 750 of 3851 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Guinea Pig anti-Insulin (Dako IR00261-2) and mouse anti-TAF4 (TAF II p135 ...
-
bioRxiv - Genomics 2021Quote: ... and bluing buffer (Dako, cat.no.: CS70230-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse HRP secondary (DAKO K400111-2), OPAL TSA 520 (Akoya # FP1487001KT) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM glutamine (Agilent, 103579-100), and 10 μM HLM006474 or DMSO (vehicle ...
-
bioRxiv - Neuroscience 2022Quote: ... in antibody diluent (Dako, Cat# S080983-2). Sections were rinsed with PBS (3x 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Physiology 2022Quote: ... in antibody diluent (Agilent, cat#S080983-2) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Neuroscience 2024Quote: Pathology pen (Agilent, cat. no. S2002002230-2)
-
bioRxiv - Physiology 2024Quote: ... and 2 mM glutamine (10359-100, Agilent). Groups of 15 islets were seeded with 5 µl volume into the corresponding detent at the bottom of the wells (29 ...
-
bioRxiv - Microbiology 2024Quote: ... and plate reader (Epoch 2, Agilent BioTek).
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM Seahorse XF glutamine (Agilent) for the mitochondrial oxidation assay or 4 mM L-glutamine for the glycolysis assay ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (Agilent Dako, Poly Rabbit, #GA52461-2), Mac2 (Bio Legend ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (Agilent Dako, Poly Rabbit, #GA52461-2), Mac2 (Bio Legend ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM glutamine (Agilent 103575-100). The long chain fatty acid oxidation stress test (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM 2-DG (Agilent, 103344-100) was added to block glycolysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2) 0.5 µL RNase Block (Agilent #300151) was added per sample (e.g ...
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality of the N=41 total RNA preparations was assessed on an Agilent TapeStation 4200 (Agilent, Santa Clara, CA, USA) and N=40 samples remained based on an RNA integrity number cut-off of > 5.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The NDec1-98 mutant was prepared using purified N-His6 Dec plasmid DNA from a DH5α bacterial culture that was obtained using a StrataPrep plasmid miniprep kit (Agilent Technologies). Replacing codon 99 with a stop codon was accomplished by site-directed mutagenesis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... After hybridisation microarray slides were washed with Gene Expression Wash Buffer 1 and Gene Expression Wash Buffer 2 (Agilent, Cat No. 5188-5327) with added Triton X-102 (0.005% final conc. ...
-
bioRxiv - Neuroscience 2022Quote: ... and then incubated 1 hour at room temperature (RT) with EnVision HRP system anti-mouse (K400111-2, Agilent Technologies, Santa Clara, CA, USA) in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... and then incubated 1 hour at room temperature (RT) with EnVision HRP system anti-mouse (K400111-2, Agilent Technologies, Santa Clara, CA, USA) in blocking solution ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were dissolved in loading solvent A (0.1% TFA in water/ACN (98:2, v/v)) and desalted on a reversed-phase (RP) C18 OMIX tip (Agilent, Santa Clara, USA). The tip was first washed 3 times with 100 μl pre-wash buffer (0.1% TFA in water/ ACN (20:80 ...
-
bioRxiv - Microbiology 2024Quote: ... Grids were then washed with PBS and blocked with 1% FBS for 5 min Grids were subsequently incubated with rabbit anti-CEA (Dako, supplemental table 2) for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... Measurements of ECAR following addition of oligomycin (2 μg/ml; MCE, USA) and 2-deoxyglucose (50 mM; Agilent, USA) allowed for the calculation of basal glycolysis and glycolytic capacity ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Genetics 2024Quote: ... the UV and LC-MS/MS raw data is batch processed (n=96, by plate) using Masshunter Qualitative Analysis (Agilent, Version 8.0) and Masshunter Quantitative Analysis (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... One microliter of each methoximated and trimethylsilylated sample was injected by 2:1 split injection by an Agilent Technologies 7693 autosampler (Agilent Technologies, Santa Clara; California) into an Agilent 7890A gas chromatograph equipped with a fused silica capillary column (0.25 mm × 30 m ...
-
bioRxiv - Cancer Biology 2021Quote: Released N-glycans were fluorescently labeled on the non-reducing end with 2-aminobenzamide (2-AB) and separated on GlycoSepN column (Prozyme) connected to HPLC system ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... and finally 50 μM 2-deoxy-glucose (2-DG) + 1μg/μL Hoechst (Seahorse XF Glycolysis Stress Test Kit, Agilent, 103020) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Slides were mounted with Glycergel (Agilent C056330-2) and air-dried overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (1003579-100, Agilent Technologies). 3-5 x 105 cells per well were plated in XF24 Seahorse Biosciences plates pre-coated with Cell-Tak (354240 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2A-D: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... anti-mouse IgG HRP-linked (P044701-2, Dako), and anti-rabbit IgG HRP-linked (P044801-2 ...
-
bioRxiv - Immunology 2022Quote: ... Dako fluorescent mounting medium (#S302380-2, Agilent, USA) was used to mount cover slips which were sealed with nail polish ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-human CD68 (Dako, M087601-2) and rabbit anti-human PD-L1 (Ventana ...
-
bioRxiv - Immunology 2022Quote: ... and 2 mM L-glutamine (103579-100; Agilent) for 1 h at 37°C ...