Labshake search
Citations for Agilent :
7401 - 7450 of 8606 citations for Estriol ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... or 1:1000 in nanopure water) were filtered through a 0.2 mm syringe filter (Agilent Captiva Econo Filter ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...
-
bioRxiv - Systems Biology 2024Quote: ... VA) or glial fibrillar acidic protein (GFAP; 1:1000; G3893-100uL; Dako, Santa Clara, CA). For Iba1 staining ...
-
bioRxiv - Cell Biology 2024Quote: ... PAECs were immunolabelled using primary mouse monoclonal antibodies against CD31 (1:25; clone JC70A; Dako) and vWF (1:50 ...
-
bioRxiv - Physiology 2024Quote: ... Organoids were stained with the anti-lysozyme antibody for imaging diluted 1:1000 (Dako, #A0099) and visualized with goat antirabbit Alexa fluor 568 (Invitrogen #A-11036) ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (astrocytic marker, 1:100, clone 6F2, Dako/Agilent, cat#M0761, Santa Clara, CA, USA), vimentin (1:100 ...
-
bioRxiv - Microbiology 2024Quote: RNA quality and integrity was inspected in 1% agarose gels and a 2100 Bioanalyzer (Agilent). rRNA depletion ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Rapsyn-FLAG and rapsyn-Venus1 E162K mutants were generated by site-directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The quality and quantity of extracted RNA were measured by on-chip electrophoresis utilizing the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). Samples exhibited 1.9≤A260/A280◻≤◻2.2 ...
-
bioRxiv - Microbiology 2019Quote: ... Complementation of ΔfimB mutants were performed by cloning the promoter and encoding regions of the parental fimB genes into pSC-A-amp/kan (Table S4) by using the StrataClone PCR Cloning Kit (Agilent Technologies, Massy, France). The recombinant plasmid was then electroporated into competent strains S250ΔfimB: ...
-
bioRxiv - Neuroscience 2021Quote: ... Biotin-labeled amplified RNA (aRNA) size distribution and quantity was analyzed with the Agilent 2100 Bioanalyser using the RNA 6000 Nano LabChip kit (Agilent Technologies, Boeblingen, Germany). Samples with lower size compressed RNA products were discarded ...
-
bioRxiv - Molecular Biology 2020Quote: ... All site-directed mutagenesis reactions were performed by following the instructions in the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene, CA). Primers used for PCR and site-directed mutagenesis reactions are indicated in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The integrity of the synthesized RNAs was assessed using Agilent RNA 6000 Nano Kit with Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), these newly synthesized sgRNA constructs will be referred to as RP Loop sgRNA (RP-loop sgRNA ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... cDNAs were then used for library preparation and the quality of the final libraries assessed on the Agilent Bioanalyzer with DNA 1000 kit (Agilent, Cat# 5067-1504). The libraries were sequenced with Illumina Nova-sequencer with a depth of 300-400 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The quality and concentration of the extracted RNA was measured with the Agilent RNA 6000 nano kit (Cat-No: 5067-1511, Agilent, Santa Clara, CA) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the RNA integrity and concentration were assessed using the RNA Nano 6000 Assay Kit for the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Then ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA integrity and 28s/18s ratio were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cell Biology 2020Quote: pSecTagNC + ΔEGF_mN1 W1758A and pSecTagNC + ΔEGF_mN1 R1994A: these plasmids were generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pSecTagNC + ΔEGF_mN1 as a template and primers ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3 + mNICD R1994A: this plasmid was generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pcDNA3 + mNICD as a template and the primer A2026VmutF.
-
bioRxiv - Biochemistry 2019Quote: ... the G6b-B mutant with mutation in the potential heparin binding site (hG6b-B K54D/K58D/R60E/R61E referred to as hG6b-B-mut) was generated with the Quick Change Site-directed mutagenesis kit (Agilent Technologies, Stockport, UK).
-
bioRxiv - Systems Biology 2019Quote: ... Translating mRNA bound to the GFP-tagged ribosomal subunit protein L10a was then pulled-down and purified (Absolutely RNA Microprep Kit, Agilent Technologies, Wilmington, DE). RNA-Seq libraries were prepared from 1 μg of purified RNA using the NEBNext Ultra RNA Library Prep Kit for Illumina with NEBNext Poly(A ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The quality of RNA samples was analyzed using the RNA 6000 Pico Kit running on the 2100 BioAnalyzer (Agilent Santa Clara, California, US). Total RNA was diluted in a final volume of 50 μL for a total input of 1 μg ...
-
bioRxiv - Biophysics 2019Quote: ... We have demonstrated that attachment of the fluorescent proteins at these sites does not interfere with SERCA activity or PLB inhibition.25,26 PLB cDNA mutations were introduced using the QuikChange mutagenesis kit (Agilent Technologies, Santa Clara, CA), and all expression plasmids were sequenced for confirmation.
-
bioRxiv - Cell Biology 2019Quote: One-color microarray-based gene expression analysis was performed using a SurePrint G3 Human Gene Expression v3 8×60K Microarray Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: The eGFP-K17E construct for the mammalian expression of the SERF1a single-point mutant eGFP-K17E was generated by site-directed mutagenesis according to the QuickChange II mutagenesis kit manual (Agilent, Santa Clara, CA), using pEGFP/SERF1a (Tab ...
-
bioRxiv - Genomics 2020Quote: ... Chromium Genome Reagents Kit Version 2 User Guide) and size and concentration determined using an Agilent 2100 Bioanalyzer DNA 1000 chip (Agilent Technologies, CA, USA). Libraries were then sequenced on an Illumina NovaSeq 6000 System following the manufacturer’s protocols (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 100 nucleotides) was verified by fluorescent capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 pico kit, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... The concentration and quality of the RNA was determined by an Agilent 2100 Bioanalyzer with the Agilent RNA 6000 Pico Kit (Agilent Technologies, #5067-1513). The oligonucleotides used for the NGS were tabulated (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was eluted into 10 μL of nuclease free water and analyzed on Agilent 2100 Bioanalyzer using the RNA 6000 Pico kit (Agilent, catalog #5067-1513). For protein analysis ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Biochemistry 2020Quote: ... USA) and RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 2 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Cancer Biology 2020Quote: Extracellular acidification rate (ECAR) was analyzed on a XF96 Extracellular Flux Analyzer using XF Glycolysis Stress Test Kit (Agilent Technology, Santa Clara, CA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total of 9 RNA libraries were prepared with three paired biological replicates for each condition including control +LIF2i ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Plant Biology 2020Quote: RNA sample concentration and purity was assessed using the DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and concentration and integrity were assessed using the Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany) in conjunction with the Agilent 2100 Bioanalyzer software according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Following visualization and an estimation of the concentration using the High Sensitivity D1000 DNA Kit on the Agilent 2200 TapeStation system (Agilent Technologies, CA, USA), the samples were pooled according to concentration ...
-
bioRxiv - Genomics 2021Quote: ... Library quality control was performed using the 2100 Bioanalyzer System with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA). The libraries were individually quantified via qPCR using a KAPA Library Quantification Kits (Kapa Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The average sample fragment length and purity was determined using Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Neuroscience 2020Quote: ... One microliter of sample was used to determine the concentration (Qubit 3.0 fluorometer) and integrity (Agilent 2100 Bioanalyzer, Agilent High Sensitivity DNA Kit). RNA sequencing was performed using the PE100 strategy (HiSeq 2500 ...
-
bioRxiv - Microbiology 2021Quote: RNA quality was evaluated spec-trometrically by Trinean Xpose (Gentbrugge, Belgium) and by fragment size distribution on an Agilent 2100 Bioanalyzer with the RNA Nano 6000 kit (Agilent Technologies, Böblingen, Germany). Electropherograms for the endpoint RNAseq samples were exported as XML files for further analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... The size distribution and concentration of s-mEV miRNA was further assessed using a 2100 Agilent Bioanalyzer with an Agilent Small RNA Kit (Agilent Technologies, CA, USA), according to the manufacturers’ instruction.
-
bioRxiv - Cancer Biology 2021Quote: ... Total amounts and integrity of RNA were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified from total RNA by using poly(T ...
-
bioRxiv - Microbiology 2019Quote: ... Library size distribution was determined using a High-Sensitivity DNA Kit run on a Bioanalyzer 2100 instrument (Agilent Technologies, Santa Clara, CA, USA). Pooled ...
-
bioRxiv - Microbiology 2019Quote: ... A synonymous mutation in the EagI site within the BSD coding sequence was then introduced to inactivate this site using a QuikChange Lightning Multi Site Directed Mutagenesis kit (Agilent, Santa Clara, CA) and the primer GCCAGCGCAGCTCTCTCTAGCGACGGGCGCATCTTCACTGGTGTCAATG ...
-
bioRxiv - Microbiology 2019Quote: ... purity was evaluated using NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies) and the integrity was verified using the Agilent RNA 6000 Pico Kit (Agilent Technologies, 5067-1513) in the 2100 Bioanalyzer Instrument (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... The sheared DNA samples were quantified and qualified on a BioAnalyzer system using the DNA7500 assay kit (Agilent Technologies cat no. 5067-1506). With an input of maximum ...
-
bioRxiv - Microbiology 2021Quote: ... samples were run on an Agilent Bioanalyzer 2100 using an Agilent High Sensitivity DNA kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Concentrations of the libraries were determined using the Qubit® dsDNA HS Assay Kit as recommended by the manufacturer (Life Technologies GmbH ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...