Labshake search
Citations for Agilent :
7251 - 7300 of 8574 citations for Human Glutamine Fructose 6 Phosphate Transaminase 1 GFPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Endogenous peroxidase was blocked using the EnVision FLEX Peroxidase-Blocking kit followed by two washes for 5 min each (Dako wash buffer). Sections were incubated for 60 min with a rabbit anti-KCNN4 primary antibody (AV35098 ...
-
bioRxiv - Genetics 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for UapA mutants was pAN510-GFP carrying a gfp-tagged uapA gene ...
-
bioRxiv - Biophysics 2019Quote: Both mutants K465A and R466A/K467A of human PDK1 were obtained by site-directed mutagenesis of the eGFP-myc-PDK1 and HA-PDK1-mCherry constructs [13] with the QuickChange mutagenesis kit (Agilent Technologies, Inc.). The oligos used for the mutagenesis were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Molecular Biology 2019Quote: ... The original eGFP-C2-DEF6 plasmid (5) was used to generate the mutant DEF6 proteins by mutagenesis PCR (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent Technologies, #210516). All mutations were verified by sequence analysis (see Suppl ...
-
bioRxiv - Genomics 2019Quote: Enrichments were performed on DNA extracted from peripheral blood using Agilent SureSelect Custom Design target-enrichment kits (Agilent, Santa Clara, CA, USA). Enrichment kits were designed to capture known pathogenic intronic variants and the protein-coding regions +/−50 nucleotides of selected NCBI RefSeq transcripts ...
-
bioRxiv - Immunology 2019Quote: ... The length distribution of the cDNA libraries was monitored using DNA 1000 kits on the Agilent bioanalyzer (Agilent, Santa Clara, CA, USA). All samples were subjected to an indexed PE sequencing run of 2×51 cycles on an Illumina HiSeq 2000 (Illumina ...
-
bioRxiv - Bioengineering 2019Quote: ... Libraries were quantified again by Qubit and size profiled on a TapeStation 4200 with a D5000 HS kit (Agilent, Santa Clara, CA), then mixed to achieve equimolar amounts of each library ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). For each sample ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... YFP-tagged DAT-PG584,585AA was created by introducing the substitutions with created with the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using wild type YFP-fagged DAT as the template ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each extracted pool of RNA was labeled separately with cy3 and cy5 dyes using the Low Input Quick Amp Labelling Kit (Agilent Technologies, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The presence of each amplicon and consistency among reactions was evaluated by electrophoresis in Agilent BioAnalyzer DNA 12,000 kits (Agilent Technologies, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: For chimera RNA sequencing we first FACS sorted GFP-expressing 500 cells and used microcapillary electrophoresis on Agilent 2100 Bioanalyzer with RNA Pico 6000 kit (Agilent, 5067-1513) to analyze RNA quality (RIN values > 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nucleotide substitutions from AT–AC to GT–AG in HD2C were introduced using the QuickChange Multi Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (Agilent, https://www.chem-agilent.com/). The plasmids for the HD2B and DROL1 genes with nucleotide substitutions and insertions were obtained by inverse-PCR and self-ligation with specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA integrity numbers (RIN) were obtained via the Agilent RNA 6000 Nano kit and the Agilent 2100 Bioanalyzer system (Agilent Technologies 2100), and all samples reached RIN > 9 (Supplementary Table 10) ...
-
bioRxiv - Microbiology 2021Quote: ... Each uniquely indexed strand specific library was assessed for library size and amount using the Agilent DNA 1000 kit (Agilent Technologies, USA). After normalization and pooling ...
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Evolutionary Biology 2019Quote: ... cDNA library quality was quantified by a 2100 Bioanalyzer using an Agilent High Sensitivity DNA Kit (#5067-4626, Agilent, Santa Clara, CA). Barcoded libraries were pooled and underwent 75 bp single-end sequencing on an Illumina NextSeq 500.
-
bioRxiv - Cell Biology 2020Quote: ... A 0.2 µg of total RNA was subjected to Cy3 labeling by in vitro transcription with use of Low Input Quick-Amp Labeling kit (Agilent Technologies, USA). Subsequently ...
-
bioRxiv - Genetics 2019Quote: ... The site-directed mutagenesis was used to generate the constructs containing the other allele not amplified from initial cloning with the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technology, USA). All the constructed plasmids were validated by sequencing and did not contain any other sequence variations ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA quality and quantity were inspected on the Agilent 2100 Bioanalyzer using the Agilent RNA 6000 Pico kit (Agilent Technologies, Inc, Germany).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We assessed the RNA integrity using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). We constructed the cDNA library using NEBNext®Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... and library quality was assessed using the Agilent High Sensitivity DNA Kit (Cat.No. 5067-4626) on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies; Santa Clara, CA, USA). RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Immunology 2021Quote: ... and quality control was performed on the Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (Cat. No. 5067-4626; Agilent, Waldbronn, Germany). Mixed libraries were sequenced on a NextSeq550 with 2 × 75 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... and RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5576, 5067-5578, 5067-5577). cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and content of total RNA were quantified using Bioanalyzer 2100 Spectrophotometers and RNA 1000 Nano LabChip Kit (Agilent, CA, USA). Total RNA was used for subsequent experiments if the total RNA samples met the following criteria ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Library preparation and sequencing were performed by Novogene Co ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Cancer Biology 2022Quote: ... The size of the collected DNA fragments was determined using a 2100 Bioanalyzer and the High Sensitivity DNA Kit (Agilent Technologies, Inc.). Libraries were run in the Rapid Run flow cell and sequenced with paired-end sequencing (2×76 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Cancer Biology 2024Quote: Quantification of glycolytic and mitochondrial ATP production was performed using the Seahorse XFe Real-Time ATP Rate Assay Kit (Agilent, #103591-100). Prior to cell adhesion ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA quality was determined by measuring the RNA integrity number (RIN) via the High Sensitive RNA Screen Tape Analysis kit (Agilent Technologies #5067) on the TapeStation system (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... were used for each replicate and placed into 100 μL of lysis buffer + β-mercaptoethanol from the Absolutely RNA Microprep kit (Agilent Technologies). Each genotype was prepared in quadruplicate ...
-
bioRxiv - Physiology 2022Quote: ... extracellular acidification rate (ECAR) and other bioenergetic parameters were measured using the Agilent Seahorse XFp Mito stress test kit (Agilent, 103010-100). Baseline and stressed OCR and ECAR were determined prior and post-injection of stressor compounds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Slides were then treated with biotinylated secondary antibodies and target staining was performed with peroxidase-conjugated streptavidin and DAB chromogen (Dako REAL Detection System Peroxidase/DAB+, Rabbit/Mouse Kit; Dako, Glostrup, Denmark). Mayer’s hematoxylin (Carl Roth ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutation of the highly cross-species conserved miR-483-3p seed target sequence from AGGAGUG to AGGAACG (mouse) was performed using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies – 200518). The HEK-293 cells were used for miR-483-3p expression studies ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA library quality and quantity were determined using an Agilent 2100 bioanalyzer using the High Sensitivity DNA Reagents kit (Agilent, 5607-4626) and then sequenced on an Illumina NovaSeq 6000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... The integrity of RNA was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). After the fragmentation was carried out ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA integrity and quantitation was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was checked pre and post poly(A)tail addition using an Agilent RNA 6000 Nano kit run on a 2100 BioAnalyser (Agilent Technologies, USA) (Fig ...
-
bioRxiv - Physiology 2024Quote: ... Library quality assessment was performed twice during the library generation protocol with the Agilent Bioanalyzer High Sensitivity dsDNA kit (Agilent; 5067-4626). Completed libraries were quantified with both the Qubit high sensitivity dsDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Measurements of aerobic respiration and glycolysis were conducted with the Seahorse Bioscience XFe96 bioanalyzer using the seahorse XF Mito Stress Test Kit (Agilent #103015-100) and the Seahorse XF Real-Time ATP Rate Assay Kit (Agilent #103592-100) ...