Labshake search
Citations for Agilent :
651 - 700 of 1765 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... squashed specimens were placed in DAKO Real Target Retrieval Solution (pH 6) (S2031; DAKO) and heated in a microwave oven (MI-77 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sections were heated in Target retrieval solution high pH (Dako, cat. no. K8004) for 20min at 97 °C before cooling to 65 °C ...
-
bioRxiv - Genetics 2023Quote: ... The system was equipped with a fused silica column (DB-5MS ultra inert; 30 m x 250 μm x 0.25 μm; Agilent J&W GC columns, Santa Clara, CA, USA) with helium used as a carrier gas under a constant flow of 1.8 ml/min ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Integrity was verified by agarose gel electrophoresis (1.5%, 100 V, 45 min; Carl Roth) and Bioanalyzer measurements (RNA 6000 Nano Assay, Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... The first reaction resulted in a plasmid containing 2,000 bp-long homologous arms (amplified from the genomic DNA of V. dahliae isolate Ls.17 using the Herculase II Fusion DNA polymerase; Agilent) flanking the neo cassette (conferring resistance to geneticin ...
-
bioRxiv - Molecular Biology 2024Quote: Data analysis for cell culture EVs was done using the Spectrum Mill MS Proteomics Workbench software package v 4.2 beta (Agilent Technologies). All extracted spectra were searched against a UniProt database containing human reference proteome sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... for which tissues was treated with heated Target Retrieval Solution pH 6.1 (S169984-2, Dako) for 30 min) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antigen retrieval was performed by boiling slides immersed in Target Retrieval Solution (DAKO, S169984-2) for 30 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... treated with antigen retrieval solution at room temperature for 20 minutes (Dako # S3020, Agilent Technologies). Slides were washed with PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... treated with antigen retrieval solution at room temperature for 20 minutes (Dako # S3020, Agilent Technologies). Slides were washed with PBS ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... Antigen retrieval was performed in a pressure cooker using retrieval solution (DAKO, Santa Clara, CA) at 100 °C for 10 min ...
-
bioRxiv - Bioengineering 2020Quote: ... Heat-mediated antigen retrieval was performed in target antigen retrieval solution (Agilent, Santa Clara, USA) for 25 min ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions, Santa Clara, CA), fibronectin (2 μg/ml clone MAB1918 ...
-
bioRxiv - Microbiology 2020Quote: ... All slides were exposed to brown chromogenic substrate DAB (Cat. #K3468, Dako Agilent Pathology Solutions), counterstained with hematoxylin ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with an antigen retrieval solution (Target Retrieval pH 9, #S2367, DAKO) for 20 min ...
-
bioRxiv - Pathology 2021Quote: ... Following a subsequent washing step with Dako washing solution® (cat. S3006, Agilent Technologies Inc.), the secondary antibody Histofine Simple Stain MAX PO® anti-goat or anti-rabbit (Nacalai USA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of paraffin-embedded tissue (3 mm) were first treated with Target Retrieval solution (DAKO) and then a cytomation serum-free protein block (DAKO ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and subjected to in solution-trypsin digest on 10µl of resin (StrataClean, Agilent, Cheshire, UK) followed by reduction and alkylation ...
-
bioRxiv - Microbiology 2020Quote: ... All slides were exposed to brown chromogenic substrate DAB (Cat. #K3468, Dako Agilent Pathology Solutions), counterstained with hematoxylin ...
-
Molecular identification of ALDH1A1 and SIRT2 in the astrocytic putrescine-to-GABA metabolic pathwaybioRxiv - Neuroscience 2023Quote: ... Cover slips were finally mounted onto slide glass with fluorescence mounting solution (S3023, DAKO, USA). Images were acquired using a Nikon A1R confocal microscope (pharmacological study ...