Labshake search
Citations for Agilent :
651 - 700 of 802 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Sample separation was done with a CP-PoraBOND Q column (50 m × 0.32 mm ID, 5 um film thickness; Agilent Technology, Netherlands) operated isothermally at 40°C using helium as a carrier gas at a flow rate of 2.0 ml/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The reaction was quenched by addition of glycerol (5% final) and desalted using a Bond Elut SepPak C18 cartridge (Agilent, MA). Methanol was used to elute oxidized GM1 species from the column and was removed by Speed Vac concentration (Savant) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were injected through a Zorbax Eclipse C8 4.6 x 150 mm 5 μm column (Agilent Technologies, Santa Clara, CA). Reference wavelengths for all three methods were set to 332 nm for TMZ and 273 nm for RG7388 ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3x 5 minutes) and incubated in the secondary antibody-horseradish peroxidase (HRP) complex as part of REAL EnVision detection system (Dako #K5007) for 1h at RT ...
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Samples were analyzed by UPLC-MS/MS at 5 µL injection volumes on a Zorbax RRHD Eclipse Plus C18 column (2.1×50mm, 1.8 μm; Agilent, Santa Clara, CA) using a Shimadzu Nexera X2 UHPLC (Shimadzu ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL of each sample was injected onto a ZORBAX SB-C18 column (5 μm, 4.6 × 250 mm) (Agilent 1260, USA). The mobile phase was composed of solvent A (water ...
-
bioRxiv - Biochemistry 2020Quote: ... [45] using an Agilent 1100 HPLC system fitted with a ZORBAX Eclipse XDB analytical C18 column (4.6×150 mm, 5 μm particle size, Agilent Technologies, USA). The bacteriocin protein was eluted using a 40-min linear water-ACN gradient (increasing the gradient to 95%).
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes (5×104 cells/well) were plated in a Seahorse XFe 24 microplate (Seahorse Biosciences/Agilent Technologies, Santa Clara, CA, USA) coated with 0.05mg/ml PDL and treated with 1 μM cisplatin or vehicle for 24h ...
-
bioRxiv - Immunology 2021Quote: ... sections were washed three times in 1 X PBS for 5 minutes and the sections allowed to dry slightly before mounting with DAKO mounting medium (Agilent Technologies) and allowing to airdry overnight in the dark at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... washed three times in PBST containing 10 µg/ml DAPI for 5 minutes and mounted with a coverslip in fluorescent mounting media (Dako, S3023). All images were taken using a Zeiss LSM 710 confocal microscope and quantified manually using ImageJ software ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and melting temperatures Tm extracted as the maxima of the first derivatives of smoothened melting curves (filter 5) using the Cary WinUV software (Version 3.0, Agilent Technologies Inc.).
-
bioRxiv - Microbiology 2021Quote: ... the fractions were injected on HPLC for purification performed on an Eclipse+ C18 column (L = 150 mm, D = 3.0 mm, Particles diameter 5 µm) (Agilent, Waldbronn, Germany). The volume injected was 100 µl ...
-
bioRxiv - Genomics 2020Quote: ... 7890A apparatus equipped with a split/splitless injector and an FID detector with an HP-5 column (J & W Scientific Columns, Agilent Technologies) 30 m × 0.32 mm and 0.25 µm film thickness.
-
bioRxiv - Molecular Biology 2020Quote: ... Scanning of the microarrays was performed with 5 µm resolution and the extended mode using a ‘High Resolution Microarray Laser Scanner’ (G2505, Agilent Technologies). Raw microarray image data were extracted and analyzed with the ‘G2567AA Image Analysis / Feature Extraction software’ (Version A.10.5.1.1 ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Biochemistry 2022Quote: ... The resulting mixture was digested with DpnI and 5 µL of the mutagenesis reaction was transformed in XL10-Gold® Ultracompetent Cells (Agilent) and selected on amplicillin-containing LB-agar plates ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Cell Biology 2022Quote: ... The absorbance was read at 450 nm (reference at 620 nm) using a Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Biotek).
-
bioRxiv - Genomics 2022Quote: ... Amplified products were purified with the Zymo Research DNA Clean & Concentrator-5 kit and then analyzed for concentration and size distribution with a HSD5000 screentape (Agilent, #5067) on an Agilent 4150 TapeStation system ...
-
bioRxiv - Microbiology 2022Quote: ... peptides were resuspended in 1ml of Buffer A (5 mM ammonium formate, pH 10.5) and separated using a 1100 series HPLC (Agilent Technologies, CA) using a Gemini NX-C18 column (4.6 x 250 mm ...
-
bioRxiv - Plant Biology 2022Quote: ... The hydroxylipids were further resolved by normal-phase HPLC (Zorbax Rx-SIL column, 2.1 x 150 mm, 5 μm, Agilent, Waldbronn, Germany) a flow rate of 0.125 ml min-1 with a solvent system that contained hexane ...
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the gliadin extracts were injected into a C18 reversed-phase Zorbax 300 StableBond column (4.6×250 mm, 5 μm, 300 Å, Agilent Technologies), maintained at 60°C ...
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the EPP and UPP extracts were separately injected into a Bio SEC-5 column (4.6×300 mm, 500 Å, Agilent Technologies), maintained at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein samples were first desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 mm, 300 µm ID’5mm, Agilent Technologies) for 3 min at a flow rate of 50 ml/min with 100% solvent A and then eluted with 70% solvent B at a flow rate of 50 ml/min for MS detection ...
-
bioRxiv - Biochemistry 2022Quote: ... C238P mutations were introduced step-wise into pDONR221-AR-AD-TAU-5* (bearing L26P, A186P, L192P and C238P mutation and previously described) using a Quickchange™ protocol with Pfu Turbo polymerase (Agilent) and the following primer pairs to generate pDONR221-AR-AD-L56P+Tau-1+Tau-5*:
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further three times with TBS-T for 5 minutes and stained with DAKO EnVision-HRP rabbit/mouse (Agilent; #K5007) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed three times for 5 min each in TBST and mouted with flourescence mounting medium (Dako, Santa Clara, USA). Images of immunofluorescence secitons were captured by confocal microcopy FV1000 (Olympus ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Cancer Biology 2024Quote: Adherent cell growth assays were performed via label free live cell imaging using the Cytation 5 Imaging Multi-Mode reader with attached BioSpa (Agilent BioTek). For 72 hr growth analysis cells were plated at ∼500 cells/well while for 144 hr growth analysis cells were plated at ∼100 cells/well ...
-
bioRxiv - Physiology 2024Quote: ... were subjected to quantitative PCR under a temperature profile of 95°C for 3 min followed by 40 cycles for 95°C for 5 sec and 58°C for 15 sec using the Stratagene Mx3000P (Agilent Technologies). For each of the samples ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fluorescence of supernatants was measured at 555/596 nm excitation/emission wavelength (Cytation 5 Multi-Mode Microplate Reader, Agilent, Waldbronn, Germany). 1X alamarBlue reagent solution in ALI medium was used as blank.
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...