Labshake search
Citations for Agilent :
651 - 700 of 2447 citations for 2' 4' Dichloro 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and incubated at 30°C for 48 hours in a microplate reader (BioTek Epoch 2, Agilent). Optical density at 600 nm (OD600 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lifted and seeded at 2×104 cells/well in XFe96 Cell Culture Microplate (Agilent Technologies) in 80 μl of fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were stained with 3,3’-diaminobenzidine solution (DAB; Liquid DAB+ Substrate Chromogen System, K346889-2, Dako), counterstained with hematoxylin ...
-
bioRxiv - Molecular Biology 2020Quote: ... membranes were incubated with rabbit anti-mouse horseradish peroxidase (HRP) conjugated antibody (P026002-2, Dako, 1:1000) as secondary antibody at RT for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... followed by EnVision FLEX DAB+ Chromogen in Substrate buffer (Agilent; anti-SARS-CoV-2, -CD8, -CD45R, -Iba1) for 10 min at RT or the DAB-Map-Kit (Ventana ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... Optical densities were recorded at 600 nm every hour in Epoch 2 Microplate Reader (Biotek, Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies and dilutions (dilution in DAKO REAL antibody diluent, S202230-2, DAKO, Carpinteria, CA, USA) used to study ALT were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Biophysics 2020Quote: Samples were thawed and injected onto a cooled (2 °C) HPLC System (Agilent Infinity 1260, Agilent Technologies) equipped with a home packed pepsin column (IDEX guard column with an internal volume of 60 µL ...
-
bioRxiv - Biophysics 2020Quote: Samples were thawed and injected onto a cooled (2 °C) HPLC System (Agilent Infinity 1260, Agilent Technologies) equipped with a home packed pepsin column (IDEX guard column with an internal volume of 60 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression data from fresh tumor tissue run by 44K Agilent Cy3/Cy5 2-color microarrays (Agilent) were available ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Immunology 2021Quote: ... Endogenous peroxidase was blocked by hydrogen peroxide prior to incubation with αCD3 (polyclonal rabbit, Agilent #IR50361-2) followed by the EnVision+ System-HRP Labelled Polymer Anti-Rabbit (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Spike mutations were introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: AAV1/2 viruses were produced by large-scale triple CaPO4 transfection of HEK293-AAV cells (#240073, Stratagene) as described previously (Van Loo et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2). Antibodies used for IHC staining of EZH2 and UBE2L6 in patients’ samples can be found in Table S3 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were plated at a density of 2×104 cells per well in a seahorse XF96 (Agilent) cell culture microplates and cultured overnight at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 150 µL respective assay medium containing 2 nM Seahorse XF Plasma Membrane Permeabilizer (Agilent 102504-100) was added after the second wash ...
-
bioRxiv - Microbiology 2021Quote: ... cuticular extracts (2 µL) or headspace samples were injected manually into a 7890A GC System (Agilent Technologies) with a DB-Wax capillary column (30 m length ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA, USA) at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were stained with DAPI and slides were mounted with DAKO mounting medium (Agilent S302380-2). Images were acquired using Leica TCS SP8 confocal microscope (Leica Microsystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... The ICP-MS apparatus was calibrated using multielement calibration standard 2A in 2% HNO3 (Agilent Technologies, USA) containing Ag ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were stained with anti-CD3 (polyclonal, Agilent Technologies, Santa Clara, CA) or anti-CD8 (D4W2Z ...
-
bioRxiv - Neuroscience 2022Quote: ... transferred onto glass slides and mounted for visualization with DAKO anti-fading mounting medium (#S302380-2 Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: The synthetic oligo pool library used for the secondary screening assay (Round 2) was obtained from Agilent. The oligonucleotides were designed to conform to the same template binding and assembly overlapping sequences as described above for the Round 1 NNK primers ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Physiology 2023Quote: ... BMSC purified with MACS were seeded at 2 × 105 cells/cm2 into XF96 tissue culture microplates (Agilent) at 24 hours prior to experiments ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Cancer Biology 2022Quote: ... rehydrated and submitted to heat-induced epitope retrieval at pH9 (Dako target retrieval solution, #S236784-2, Agilent) and 97°C for 10 min in a Lab Vision PT module (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody detection was performed using EnVision FLEX/HRP (GV80011-2, Dako, Agilent Technologies, Santa Clara, CA, USA). IHC pictures were taken with a Pannoramic 250 Flash II Digital Slide Scanner and analyzed with the Pannoramic Viewer (3DHISTECH Ltd. ...