Labshake search
Citations for Agilent :
6851 - 6900 of 8613 citations for Testosterone ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... And RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The library fragments (370 ~ 420 bp in length ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA libraries were barcoded individually and analyzed for quantity and quality with the High Sensitivity DNA Analysis Kit in the Agilent 2100 Bioanalyzer (Agilent, USA). cDNA libraries were pooled in equal amounts for sequencing (single end ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent). Variants of the wild type sigAP and sigAP”ext-10” (harboring the T-17G-16T-15G-14 motif ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Physiology 2022Quote: ... The real-time extracellular acidification rate (ECAR) was measured using the XFe96 extracellular flux analyzer with the Glycolysis Stress Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... and the size distribution was confirmed using a High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies, Cat. No. / ID: 5067-4626). Libraries were sequenced on an Illumina NextSeq2000 in paired end mode with the read length of 50 nt and sequencing depth of 20 million reads per library ...
-
bioRxiv - Microbiology 2022Quote: ... on a Qubit Fluorometer (invitrogen) and fragment length was assessed with an Agilent 2100 Bioanalyzer (Agilent High sensitivity DNA Kit, Agilent). Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Cell Biology 2024Quote: Mutations in the DFCP1 (K193A and R266Q) and ATGL (D166G) were introduced using the QuikChange mutagenesis kit (Agilent, Santa Clara, CA).
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... RNA integrity was assessed using an RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... and extracellular acidification rate (ECAR) were measured following the manufacturer’s instructions for the Seahorse XF Cell Mito Stress Test Kit (Agilent, Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... The quality and quantity of each library was analyzed on the Bioanalyzer with a High Sensitivity DNA analysis Kit (Agilent technologies) and Collibri Library Quantification Kit (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... The quality and quantity of each library was analyzed on the Bioanalyzer with a High Sensitivity DNA analysis Kit (Agilent technologies) and Collibri Library Quantification Kit (Invitrogen).
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment was gel purified and used as template in error-prone PCR (EP-PCR) using the GeneMorph II kit and Mutazyme II polymerase (Agilent Technologies) and the primers (5RT 3RT) ...
-
bioRxiv - Biophysics 2024Quote: The recombinant human Cα subunit of cAMP-dependent protein kinase with the Phe to Ala mutation in position 100 (PKA-CF100A) was generated from the human PKA-Cα wild-type using Quik-Change Lightning mutagenesis kit (Agilent genomics). The key resource table lists the PCR primers used to modify the pET-28a expression vector encoding for the wild-type human PKA-Cα gene (PRKACA – uniprot P17612 ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were obtained from ATCC (CRL-3216) and verified to be free from mycoplasma contamination using the MycoSensor PCR Assay Kit (Agilent Technologies). Cells were cultured as in DMEM (Lonza ...
-
bioRxiv - Biophysics 2023Quote: ... or K280C (T) as well as the C242A mutation were introduced into the pETM30 vector using the QuikChange® mutagenesis kit (Stratagene) (17) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Post cDNA amplification and post-library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067–4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was fragmented into 180–280 bp by sonication and subjected to library preparation using the Agilent SureSelect Human All Exon V6 Kit (#5190-8864, Agilent Technologies). The enriched libraries underwent paired-end 150bp sequencing on the Illumina HiSeq 2000 platform.
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondrial probes used for visualization of mt-mRNA and mt-rRNA levels were restriction fragments labeled with α-32P-dCTP and a random priming kit (Agilent). Different mitochondrial tRNAs and 7S RNA were detected using specific oligonucleotides labeled with ψ-32P-ATP ...
-
bioRxiv - Physiology 2024Quote: ... Sample integrity was assessed prior to library preparation using the Bioanalyzer 2110 system with an RNA Nano 6000 Assay Kit (Agilent Technologies). One hundred fifty-base paired-end sequencing was performed using an Illumina NovaSeq platform according to manufacture instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were analyzed on Fragment Analyzer with Genomic DNA 50kb Kit and TapeStation with either High Sensitivity D5000 ScreenTape System or High Sensitivity RNA ScreenTape System (Agilent Technologies) according to the manufacturer’s protocols [41-43] ...
-
bioRxiv - Genomics 2024Quote: ... The RNA quantity was assessed using the NanoDrop ND-1000 Spectrophotometer (Nanodrop Technologies) and the Agilent 2100 Bioanalyzer with the RNA 6000 Nano LabChip kit (Agilent Technologies). For DNA isolation ...
-
bioRxiv - Neuroscience 2024Quote: ... and assessed for RNA integrity using an RNA Kit on an Agilent 5300 Fragment Analyzer (Agilent Technologies, Palo Alto, CA, USA). The sequencing libraries were then multiplexed and loaded onto the Illumina NovaSeq 6000 instrument’s flowcell ...
-
bioRxiv - Neuroscience 2024Quote: ... The library molarity was determined by measuring the library size (approximately 330 bp) using the Fragment Analyzer 5300 and the Fragment Analyzer DNA HS NGS fragment kit (Agilent Technologies) and the library concentration (>2 ng/µl ...
-
bioRxiv - Immunology 2024Quote: ... we first inserted the SalI site at just downstream of the termination codon of the dsRed cDNA of pIRES2-dsRed-IRF418 using a QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), and isolated the BglII-SalI fragment containing the mIRF4-IRES-dsRed DNA region from the mutated plasmid ...
-
bioRxiv - Genomics 2024Quote: ... quality control was performed by run on an Agilent 2100 Bioanalyzer System using the High Sensitivity DNA Kit (Agilent, 5067-4626). Libraries were then created from each fraction using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... The quality of the RNA samples was assessed using an Agilent 2100 Bioanalyzer (RNA 6000 Nano Kit, 5067-1511, Agilent technologies) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA integrity was initially assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), and only RNA samples with an RIN value above 4 were selected for further processing ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality and size were assessed using an Agilent 4200 TapeStation with a gDNA ScreenTape Kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2024Quote: ... Library pools concentrations were measured using Qubit dsDNA HS Assay Kit and the quality of the libraries was assessed by High Sensitivity D5000 ScreenTape (Agilent Technologies), followed by sequencing using Illumina NextSeq500.
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from cells under the indicated experimental conditions using a Qiagen miRNAeasy kit (Valencia) and measured using an Agilent Bioanalyzer (Agilent Technologies). Illumina Novaseq 6000 libraries were prepared and sequenced by Novogene (CA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 libraries were generated from murine tissue samples and libraries were quantified using the Agilent DNA 1000 kit (Agilent Technologies, USA).
-
bioRxiv - Immunology 2023Quote: ... The predicted CLIPA8 cleavage site 63IMLR66 was replaced by IEGR [26] using the CLIPA8mutag primer and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to create plasmid pOET3-CLIPA8Xa-V5-His (Table S3) ...
-
bioRxiv - Biochemistry 2023Quote: ... was used as a template to generate deletion variants for expression in insect cells using the QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). For bacterial expression of the ΔN790 variant ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control for the constructed library was performed by the Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies; Catalog # 5067-4626), while Qubit DNA HS Assay Kit was used for qualitative and quantitative analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantification and quality checked of libraries was done using an Agilent 2100 Bioanalyzer instrument and a DNA 7500 kit (Agilent Technologies). Libraries were pooled and sequenced on a NovaSeq6000 S1 100 cycle run (v1.5 SBS reagents) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of each library was assessed using a Bioanalyzer high sensitivity kit on an Agilent 2100 Bioanalyzer (Agilent 5067-4626). The libraries were submitted for sequencing at Cancer Research UK Cambridge Institute Genomic Core Facility using Illumina NovaSeq with 100bp single-end reads.
-
bioRxiv - Cell Biology 2023Quote: The NGS sample was diluted with TE buffer and assayed using a High Sensitivity DNA Kit (cat. #5067-4626, Agilent Technologies) on a Bioanalyzer 2100 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... RNA quantity and quality were assessed using NanoDrop ND-1000 Spectrophotometer (Nanodrop Technologies) and Agilent 2100 Bioanalyser (RNA 6000 Nano LabChip kit, Agilent Technologies).
-
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsivenessbioRxiv - Immunology 2023Quote: Seahorse experiments were performed on sorted CD8+ cells activated in presence or absence of LSDi using XF Cell Mito Stress kit (Seahorse Bioscience). OCR and ECAR were measured with XF96 Extracellular Flux Analyzers (Seahorse Bioscience) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutations G to C at positions 445 and 457 were introduced into DCP2 in plasmid pQZ145 (Zeidan et al. 2018) using primers AKV005/AKV006 and the Quick-change Site-Directed mutagenesis kit (Agilent, 200519), generating plasmid pAV008 containing dcp2-E149Q,E153Q ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoter Capture was carried out using Hi-C libraries from three Vehicle-treated tumour samples and three Decitabine-treated tumour samples with the SureSelect target enrichment system and RNA bait library according to manufacturer’s instructions (Agilent Technologies kit), using 12 post-capture PCR cycles as required ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The L834R mutation was introduced in EGFR using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). The plasmid used for the neural network training encoded for the extracellular and transmembrane domain (ECTM ...
-
bioRxiv - Microbiology 2022Quote: ... C194 in NlpC/P60Ela and C153 in in NlpC/P60Sne were changed to alanine using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The respective sense and antisense primers listed in Supplementary Table 1 were used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the broad range RNA assay and rudimentary cDNA quality and size information was obtained from an Agilent 2100 Bioanalyzer with a Broad Range DNA Kit (Agilent, USA). For Qubit conversions from ug to picomoles cDNA ...