Labshake search
Citations for Agilent :
6651 - 6700 of 7968 citations for Mouse Antigen peptide transporter 2 TAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... psub-201 [61] containing the full-length AAV2 genome as template and the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... The kinase domain c-Abl mutations were introduced into the human c-Abl kinase domain by site-directed mutagenesis using the QuikChange II kit (Agilent) and verified by DNA sequencing.
-
bioRxiv - Biochemistry 2021Quote: ... AccuScript high-fidelity first-strand cDNA synthesis kit for reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) was procured from Agilent.
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Developmental Biology 2021Quote: ... the PCR products from the genotyping of the first outcross (generation F1) were cloned into the cloning vectors provided by the StrataClone PCR cloning kit (Stratagene). The cloning was performed according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... The ethanol was removed carefully and the resulting RNA extract was resuspended in 10 μL RNase-free water for immediate analysis (RNA 6000 Nano kit, Bioanalyzer instrument and the Bioanalyzer 2100 software, Agilent).
-
bioRxiv - Evolutionary Biology 2021Quote: Cys to Ala substitution mutations were introduced at specific sites in the ectodomain of wild type toll by using QuickChange II XL site-directed mutagenesis kit (Stratagene) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Quality and quantity of fragmented DNA and the library for sequencing were analyzed by Bioanalyzer (Agilent High Sensitivity DNA kit). To identify variants from the whole genome sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... RNA integrity was assessed using the RNA Nano 6000 assay kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Libraries were prepared for sequencing by Cambridge Genomics Services using 3 μg of total RNA and an Ultra™ RNA library prep kit for Illumina (NEB ...
-
bioRxiv - Genomics 2020Quote: ... The indicated domain deletions and point mutations were generated by site-directed mutagenesis using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent). For CD34+ HSPC cultures ...
-
bioRxiv - Immunology 2020Quote: ... quantified by Nanodrop and the quality was assessed using an Agilent Bioanalyzer (Agilent, Cheshire, UK. The two-color low input Quick Amp Labelling kit (Agilent) was used to Cy3- or Cy5-fluorescently label cRNA samples ...
-
bioRxiv - Microbiology 2021Quote: ... Insertion of the desired point mutations in S-RBD was done using QuickChange II site directed mutagenesis kit (Agilent Technologies). Primers for mutagenesis were designed using The QuickChange® Primer Design Program provided by manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCS to generate pGEMT-EZ-Sph-UPF1-FLAG-Sac.The UPF1-Xho-Sph gene fragment in plasmid vector pQ (Quintarabio) was mutagenized with oligonucleotides 5Upf1C62Ymut and 3Upf1C62Ymut using the QuikChange II XL site directed mutagenesis kit (Agilent). The UPF1XhoI-C62Y-SphI fragment was isolated and ligated with the 2.28 kb Sph-UPF1-FLAG-Sac fragment from pGEMT-EZ-Sph-UPF1-FLAG-Sac into the XhoI-SacI site of the MCS of pRS425.
-
bioRxiv - Microbiology 2020Quote: Site directed mutagenesis was performed on pGAPZα-His-MspGH25 vector according to the instructions of the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis was carried out according to the manufacturer’s instructions for the QuikChange II site-directed mutagenesis kit (Agilent Technologies), or by PCR-overlap extension (Ho et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies, Cheshire, UK) and measured with an Agilent Bioanalyser ...
-
bioRxiv - Microbiology 2020Quote: ... Expression vectors encoding the six different mutants of HIV-2 Env cytoplasmic tail were created by introducing stop codon in different position within the cytoplasmic tail by site-directed mutagenesis using the QuickChange II Site-Directed Mutagenesis Kit (Agilent). HIV-2 Env mutants were as follows ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA quantity and purity were analysed using a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA), all samples had RIN numbers >7.0 ...
-
bioRxiv - Microbiology 2020Quote: ... 2009) was created by site-directed mutagenesis of pHT304-Pxyl-mogR using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene) and primers 5’-tccaaaaacagaaagtcaattggcagctacgtattataaattgaaaaaacgtg-3’ and 5’-cacgttttttcaatttataatacgtagctgccaattgactttctgtttttgga-3’ (mutated bases underlined) ...
-
bioRxiv - Molecular Biology 2021Quote: All the mutants used in this study were generated by site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis kit (Stratagene).
-
bioRxiv - Molecular Biology 2021Quote: ... A targeted mutation in the Nudix motif was introduced through use of the QuikChange site-directed mutagenesis kit (Agilent Technologies) to produce a plasmid encoding L375 (E258Q).
-
bioRxiv - Immunology 2020Quote: ... with 1 μL used to check the expected size (~300 bp) and the samples’ purity were verified with the Agilent High Sensitivity DNA Kit as manufacturer’s recommendation (Agilent Technologies). One μL of the diluted libraries were used to quantify as recommended in the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 1μl of each sample was used for quality and concentration analysis on a 2100 Bioanalyzer using the RNA 6000 Nano kit (Agilent). 500ng of RNA was used to prepare each mRNA library ...
-
bioRxiv - Microbiology 2021Quote: Mutations were introduced into the HA plasmid of A/Hong Kong/1/1968 using a site-directed mutagenesis kit (QuikChange; Stratagene). 2:6 recombinant IAVs containing wt and modified HA of A/Hong Kong/1/1968 ...
-
bioRxiv - Immunology 2021Quote: ... The D614G mutation was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cy3-labelled probes were prepared from RNA using Low Input Quick Amp Labeling Kit 1-color (Agilent Technologies, #5190-2305) and hybridized with the custom microarrays (ID:085740 ...
-
bioRxiv - Genomics 2019Quote: ... 1uL of 15uL total from each sample was subjected to Agilent Bioanalyzer analysis using the Total Eukaryotic RNA Pico kit (Agilent). All samples demonstrated significant enrichment of Sox9 across EGFP population and had RIN values ≥ 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... RUVBL2 and siRNA-resistant RUVBL2 ATPase mutant (E300G) were constructed by site-directed mutagenesis of Flag-TIP49b (RUVBL2) using QuikChange site-directed mutagenesis kit (Agilent). His-NFAT5171-250-AcGFP ...
-
bioRxiv - Genomics 2021Quote: ... The shape and the mean fragment size of the libraries were determined on a 5200 Fragment Analyzer using the HS NGS Fragment Kit 1-6000 bp (both Agilent). Enriched libraries were loaded with a final concentration of 10 pM on a MiSeq Flow Cell using v3 reagent chemistry for 2×150 cycles.
-
bioRxiv - Genomics 2021Quote: ... Integrity was assessed using Agilent RNA 6000 Nano Kit on a 2100 Bioanalyzer instrument (Agilent Technologies, Santa Clara, CA, USA). The RIN score and the percentages of fragments larger than 200 nucleotides (DV200 ...
-
bioRxiv - Genomics 2020Quote: ... 10X-barcoded full-length cDNA was then amplified via PCR and analyzed using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent). Up to 50 ng of cDNA was carried over to construct gene expression libraries and was enzymatically fragmented and size-selected to optimize the cDNA amplicon size prior to 5’ gene expression library construction ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutagenesis of the A2REs in the Ins1 5’-UTR was performed with the QuikChange II Site-directed mutagenesis kit (Agilent). Cells were co-transfected with each pNL1.1 construct and the pGL4.54 for normalization ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
bioRxiv - Biochemistry 2021Quote: ... Cys to Ala mutants of Flag-tagged DJ-1 were using QuikChange Ⅱ Site-Directed Mutagenesis kit (Agilent Technologies, USA) according to the manufacturer’s protocol ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... the ChT swapping mutants using fusion PCR and the point mutations using site-directed mutagenesis by a QuikChangeII kit (Agilent) with the primers listed in supplemental information (Table S1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The different KlGAL80 alleles were generated by site-directed mutagenesis using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) or by fusion PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The different GAL80 alleles were generated by site-directed mutagenesis using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) or by fusion PCR ...
-
bioRxiv - Immunology 2021Quote: ... Precise measurements of glycolysis in ILC2s were carried out using the Seahorse XF Glycolytic Rate Assay Kit (Agilent; 103344-100) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Average library molecular size was determined using the DNA High Sensitivity Assay kit with the Agilent 2100 Bioanalyzer (Agilent Technologies). The Library was then used to generate paired end reads over 150 cycles at the UC Davis DNA Sequencing Technologies Core facility on the Illumina HiSeq 4000 system.
-
bioRxiv - Microbiology 2021Quote: ... and average fragment size of each sample was assessed using an Agilent 2100 Bioanalyzer system and RNA 6000 Nano kit (Agilent) prior to sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... conversion of both the pre TM1 and the TM2-TM3 loop from the chimera to the corresponding α9 sequence was performed by QuikChange Multi Site-Directed Mutagenesis kit (Stratagene) using primers 5’GGCATGCTCTCGGCCACCATCAGCTGGAAGACGG3’ and 5’GGGCAGCAGGAGGTTGACGATGTAGAATGAAGAGCGGCGCTTCAG3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies) and quantified using the KAPA Library Quantification Kit for Illumina (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using a Qubit RNA assay kit and checked for quality using a High Sensitivity RNA ScreenTape on a TapesStation (Agilent). RNA integrity scores are typically 7.0 and greater ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... the RIN (RNA integrity number) value of RNA isolated from tissue culture was determined using the Agilent RNA 6000 Pico Kit (#5067-1513 Agilent) with a 2100 Bioanalyzer (#G2939BA Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were verified on an Agilent 2100 bioanalyzer with a High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for the average fragment length calculation and evaluation of quality and on Qubit 2.0 ...
-
bioRxiv - Biochemistry 2022Quote: Human ALDH9A1 mutants were generated from the template plasmid (EX-Z3075-M29) described above using a QuickChange XL II Site-Directed Mutagenesis Kit (Agilent). Primers were designed with the corresponding mutations as prescribed by the QuickChange Primer Design tool (https://www.agilent.com/store/primerDesignProgram.jsp ...