Labshake search
Citations for Agilent :
6601 - 6650 of 7078 citations for Ceruloplasmin Colorimetric Activity Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... A BsrG1 site within the TOLLIP cDNA was eliminated by mutation using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Catalog #210518) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Catalog #210518). Primers were designed using the QuikChange Primer Design website ...
-
bioRxiv - Developmental Biology 2022Quote: ... we introduced several point mutations variants in the Pax8 binding site using the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) to generate the CNS1 mut-Luc vector ...
-
bioRxiv - Cell Biology 2022Quote: ... MD and mutated at AKAP12’s activation-responsive sites (S/T to A mutations) using the QuikChange II® site-directed mutagenesis Kit (Stratagene, CA) as we described previously (54) ...
-
bioRxiv - Cell Biology 2022Quote: Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of NSPCs was measured using the Seahorse XF Cell Energy Phenotype Test Kit (Agilent, # 103325-100), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A subset of samples was quality controlled to check the RIN values by Bioanalyzer using the RNA 6000 Pico Kit (Agilent, 5067-1513). The RINs were between 8.2 and 10 ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: Mutagenesis of His 359 and Glu 363 to Alanine in human MYC (MycHEA mutant) was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies # 200519), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... HSF1-S326A and HSF1-T527A were carried out using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: mRNA in total RNA was converted to cDNAby using AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA) following the method described elsewhere (17) ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA integrity number (RIN) of total RNA was quantified by an Agilent 2100 Bioanalyzer using an Agilent RNA 6000 Nano Kit (Agilent, 5067-1511). Total RNAs with an average RIN value of 8.52 ± 0.05 were used for RNA-seq library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Site-directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Microbiology 2022Quote: ... DNA and RNA quality was checked with the Agilent 2100 Bioanalyzer and the High sensitivity DNA/RNA kit (Agilent, Santa Clara, USA).
-
bioRxiv - Systems Biology 2022Quote: ... The library quality was assessed by an Agilent 2000 Bioanalyzer with Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for fragment sizes of 500–1000 bp ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA quantity and purity were analyzed using an RNA 6000 Nano LabChip Kit and a Bioanalyzer 2100 (Agilent, Santa Clara, CA). High quality RNA samples with RIN number > 7 were used to construct the sequencing library ...
-
bioRxiv - Genetics 2022Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Cell Biology 2022Quote: ... Full-length GFP-LRRK2 harboring an R361A mutation was generated by site-directed mutagenesis of pcDNA5 FRT/TO GFP-LRRK2 (DU13363) using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, 210518) according to the manufacturer’s protocol and the following mutagenic primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The total RNA quantity and purity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (5067-1511, Agilent, CA, U.S.), high-quality RNA samples with RIN number > 7.0 were used to construct sequencing library ...
-
bioRxiv - Immunology 2019Quote: A deleted version of pNL4-3 was constructed (18) that lacks the entire Gag and Protease region (Stratagene Quick-Change XL kit) replacing this region with a BstE II (New England Biolabs ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Physiology 2019Quote: ... Endogenous peroxidase was blocked using the EnVision FLEX Peroxidase-Blocking kit followed by two washes for 5 min each (Dako wash buffer). Sections were incubated for 60 min with a rabbit anti-KCNN4 primary antibody (AV35098 ...
-
bioRxiv - Genetics 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for UapA mutants was pAN510-GFP carrying a gfp-tagged uapA gene ...
-
bioRxiv - Biophysics 2019Quote: Both mutants K465A and R466A/K467A of human PDK1 were obtained by site-directed mutagenesis of the eGFP-myc-PDK1 and HA-PDK1-mCherry constructs [13] with the QuickChange mutagenesis kit (Agilent Technologies, Inc.). The oligos used for the mutagenesis were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Molecular Biology 2019Quote: ... The original eGFP-C2-DEF6 plasmid (5) was used to generate the mutant DEF6 proteins by mutagenesis PCR (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent Technologies, #210516). All mutations were verified by sequence analysis (see Suppl ...
-
bioRxiv - Genomics 2019Quote: Enrichments were performed on DNA extracted from peripheral blood using Agilent SureSelect Custom Design target-enrichment kits (Agilent, Santa Clara, CA, USA). Enrichment kits were designed to capture known pathogenic intronic variants and the protein-coding regions +/−50 nucleotides of selected NCBI RefSeq transcripts ...
-
bioRxiv - Immunology 2019Quote: ... The length distribution of the cDNA libraries was monitored using DNA 1000 kits on the Agilent bioanalyzer (Agilent, Santa Clara, CA, USA). All samples were subjected to an indexed PE sequencing run of 2×51 cycles on an Illumina HiSeq 2000 (Illumina ...
-
bioRxiv - Bioengineering 2019Quote: ... Libraries were quantified again by Qubit and size profiled on a TapeStation 4200 with a D5000 HS kit (Agilent, Santa Clara, CA), then mixed to achieve equimolar amounts of each library ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). For each sample ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... YFP-tagged DAT-PG584,585AA was created by introducing the substitutions with created with the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using wild type YFP-fagged DAT as the template ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each extracted pool of RNA was labeled separately with cy3 and cy5 dyes using the Low Input Quick Amp Labelling Kit (Agilent Technologies, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The presence of each amplicon and consistency among reactions was evaluated by electrophoresis in Agilent BioAnalyzer DNA 12,000 kits (Agilent Technologies, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: For chimera RNA sequencing we first FACS sorted GFP-expressing 500 cells and used microcapillary electrophoresis on Agilent 2100 Bioanalyzer with RNA Pico 6000 kit (Agilent, 5067-1513) to analyze RNA quality (RIN values > 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nucleotide substitutions from AT–AC to GT–AG in HD2C were introduced using the QuickChange Multi Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (Agilent, https://www.chem-agilent.com/). The plasmids for the HD2B and DROL1 genes with nucleotide substitutions and insertions were obtained by inverse-PCR and self-ligation with specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA integrity numbers (RIN) were obtained via the Agilent RNA 6000 Nano kit and the Agilent 2100 Bioanalyzer system (Agilent Technologies 2100), and all samples reached RIN > 9 (Supplementary Table 10) ...
-
bioRxiv - Microbiology 2021Quote: ... Each uniquely indexed strand specific library was assessed for library size and amount using the Agilent DNA 1000 kit (Agilent Technologies, USA). After normalization and pooling ...
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Evolutionary Biology 2019Quote: ... cDNA library quality was quantified by a 2100 Bioanalyzer using an Agilent High Sensitivity DNA Kit (#5067-4626, Agilent, Santa Clara, CA). Barcoded libraries were pooled and underwent 75 bp single-end sequencing on an Illumina NextSeq 500.
-
bioRxiv - Cell Biology 2020Quote: ... A 0.2 µg of total RNA was subjected to Cy3 labeling by in vitro transcription with use of Low Input Quick-Amp Labeling kit (Agilent Technologies, USA). Subsequently ...
-
bioRxiv - Genetics 2019Quote: ... The site-directed mutagenesis was used to generate the constructs containing the other allele not amplified from initial cloning with the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technology, USA). All the constructed plasmids were validated by sequencing and did not contain any other sequence variations ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA quality and quantity were inspected on the Agilent 2100 Bioanalyzer using the Agilent RNA 6000 Pico kit (Agilent Technologies, Inc, Germany).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We assessed the RNA integrity using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). We constructed the cDNA library using NEBNext®Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... and library quality was assessed using the Agilent High Sensitivity DNA Kit (Cat.No. 5067-4626) on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... Whole-exome sequencing libraries were prepared using SureSelectXT Human All Exon V5 + UTR kit (75 Mb; Agilent technologies, Santa Clara, CA, USA) as per manufacturer’s instructions and sequenced on HiSeq 2000 to generate paired end 2 × 100bp sequence reads (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies; Santa Clara, CA, USA). RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Immunology 2021Quote: ... and quality control was performed on the Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (Cat. No. 5067-4626; Agilent, Waldbronn, Germany). Mixed libraries were sequenced on a NextSeq550 with 2 × 75 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... and RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5576, 5067-5578, 5067-5577). cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and content of total RNA were quantified using Bioanalyzer 2100 Spectrophotometers and RNA 1000 Nano LabChip Kit (Agilent, CA, USA). Total RNA was used for subsequent experiments if the total RNA samples met the following criteria ...