Labshake search
Citations for Agilent :
601 - 650 of 989 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Genomics 2021Quote: ... using a mixture of equal volume of ready-to-use protein block serum-free solution (Agilent Dako ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Developmental Biology 2020Quote: ... the slides were further washed and blocked in protein block serum-free buffer (Dako, Cat # X0909). The slides were incubated with AIBP antibody for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... then stained with: rabbit polyclonal (pAb) glial fibrillary acidic protein (GFAP,1:1000, Dako, Z033401-2), goat pAb glial fibrillary acidic protein (GFAP,1:300 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The labeled proteins were subjected to digestion with Sialidase A (Agilent Technologies, Santa Clara, CA, USA), β1-4 galactosidase (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Primary antibodies used for immunofluorescence were polyclonal rabbit anti-glial fibrillary acidic protein antibody (GFAP; DAKO, Santa Clara ...
-
bioRxiv - Microbiology 2021Quote: ... The molecular weights for each rNA were estimated using an AdvanceBio SEC 300Å protein standard (Agilent) of known molecular weights that was included in the run and the presence of NA in each fraction was measured with the Mu-NANA assay.
-
bioRxiv - Microbiology 2021Quote: ... Separation of digested protein samples was performed on an Agilent 1290 Infinity HPLC system (Agilent Technologies). Samples were loaded on a 100 µm × 20 mm trap column (in-house packed with ReproSil Pur C18-AQ ...
-
Long-term alterations in brain and behavior after postnatal Zika virus infections in infant macaquesbioRxiv - Neuroscience 2019Quote: ... we performed immunohistochemical (IHC) analysis by using antibodies against Glial fibrillary acidic protein (Agilent Technologies, M0761), NeuN (EMD Millipore ...
-
bioRxiv - Microbiology 2020Quote: ... biotinylated recombinant TRAP proteins (Table 1) were oligomerized around a streptavidin-conjugated Phycoerythrin (PE) (PJRS2, Prozyme) creating TRAP-PE staining complexes ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 µg of anti-HA antibody (12CA5) was immobilized on Protein A cartridges (Agilent, G5496-60000), using the in-built immobilization methodology ...
-
bioRxiv - Microbiology 2021Quote: ... the protein was digested by trypsin overnight and the digested peptides were purified with ZipTips (Agilent). Using a Dionex UltiMate 3000 RSLCnano system equipped with a Dionex UltiMate 3000 RS autosampler ...
-
bioRxiv - Neuroscience 2020Quote: ... Peptide/protein identifications and quantitative analysis were performed using Spectrum Mill (Agilent Technologies, Santa Clara, CA) as described previously ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1mL fractions were collected and protein was concentrated by incubation with 4μL StrataClean resin (Agilent Technologies) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... Recombinant proteins were expressed in BL21-CodonPlus (DE3)-RILP Competent Cells (Agilent Technologies, Santa Clara, CA) and purified using Glutathione Sepharose 4B Media (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... FcγR binding was quantified by incubating immune complexes with biotinylated FcγRs (FcγRIIB, FcγRIII, and FcγRIV, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Neuroscience 2020Quote: ... All recombinant proteins were expressed in the BL21-Gold (DE3) pLysS strain of Escherichia coli (Agilent) in pGEX-KG vectors as glutathione S-transferase (GST ...
-
bioRxiv - Biophysics 2021Quote: ... Separation of digested protein samples was performed on an Agilent 1290 Infinity HPLC system (Agilent Technologies). Samples were loaded on a 100 µm × 20 mm trap column (in-house packed with ReproSil-Pur C18-AQ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antigens (for HE1-, or LL-) proteins were detected using 10 mg tablets of DAB (Dako Cytomation) diluted in 5 ml Tris-buffer (brown colour).
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP) antibody (RRID:AB_10013382; Dako Agilent, Santa Clara, CA, USA, #z0334), mouse anti-DCX (RRID:AB_10610966 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP) antibody (RRID:AB_10013382; Dako Agilent, Santa Clara, CA, USA, #z0334), mouse anti-DCX (RRID:AB_10610966 ...