Labshake search
Citations for Agilent :
601 - 650 of 2673 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Microbiology 2022Quote: ... Crude peptide was subsequently purified by reverse phase high-pressure liquid chromatography on a C18 semiprep column over an acetonitrile gradient with 0.1% trifluoroacetic acid and analyzed by liquid chromatography triple quadrupole mass spectrometry (Agilent).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... then reconstituted in 1 mL of 0.1 % trifluoroacetic acid and desalted using an Agilent Macroporous Reversed-Phase C18 column (4.6 × 50 mm mRP-C18, Agilent) on a 1260 Infinity HPLC system (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... Periodic acid-Schiff (PAS) and hematoxylin and eosin (H&E) staining were performed using standard procedures (Dako, Glostrup, Denmark) for the assessment of normal structures.
-
bioRxiv - Microbiology 2024Quote: ... Cell free supernatants were acidified with formic acid (0.1% final concentration) and analysed by GC-FID using a DB-FFAP column (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Separation of amino acid was done with a Zorbax Eclipse XDB-C18 column (50 × 4.6 mm, 1.8 μm, Agilent Technologies). The mobile phase comprised of solvent A (water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Amino acid deletions for ΔKPQ were generated by use of the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent, USA). PCR products were cloned into XL-10 Gold Ultracompetent cells ...
-
bioRxiv - Physiology 2024Quote: ... Peptides were reconstituted in 50 µL 15% ACN/0.1% acetic acid and analyzed on an 1290 Infinity II LC system (Agilent) coupled to QTRAP instrument (Sciex ...
-
bioRxiv - Cell Biology 2024Quote: ... All point mutations and amino acid deletions were incorporated into constructs using the QuikChange site-directed mutagenesis kit (Agilent). All constructs were expressed using either the pINDUCER20-C1-EGFP lentiviral vector (Crawley et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... oligomycin (1 µM) and 2-deoxy-D-glucose (2-DG) (50 mM) (Seahorse Glycolysis Stress Test Kit, Agilent Technologies, 103020-100). Analyses were performed with Wave software 2.3.0 ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...