Labshake search
Citations for Agilent :
601 - 650 of 4434 citations for 1 4 Dichloro 2 5 bis dichloromethyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine solution (cat 103579-100) (Agilent). Neuron cultures were transferred to a non-CO2 incubator for 1 hour prior to running the assay ...
-
bioRxiv - Physiology 2024Quote: ... and 2 mM L-Glutamine (Agilent #103579-100), and incubated at 26°C in a CO2-free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted with mounting medium (S302380-2, Dako) on microscope slides.
-
bioRxiv - Neuroscience 2024Quote: ... total tau (Agilent Technologies, A002401-2, CA, USA), PHF1 (kindly gift from late Dr ...
-
bioRxiv - Neuroscience 2024Quote: ... or Dako EnVision Flex hemotoxylin (K800821-2, Dako). Slides were dehydrated in an ascending ethanol series and cleared in xylene before cover slipping with Cytoseal 60 (22-244-256 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM Glutamine (Agilent Technologies, 103579-100). HDLECs were maintained for 1 hour in a CO2-free incubator at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of each sample was injected in splitless and split 1:10 mode into a 6890N gas chromatograph (Agilent Technologies Inc. Santa Clara, CA) coupled to a Pegasus 4D TOF mass spectrometer (LECO ...
-
bioRxiv - Immunology 2022Quote: ... and a tyramide-barcode staining cycle performed for mouse anti-MUM1 primary antibody (1:100 dilution, clone MUM1p, Agilent Dako Products, catalog number GA64461-2). However ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Developmental Biology 2024Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...