Labshake search
Citations for Agilent :
6351 - 6400 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... which were assessed by the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were prepared using the NEB Next Ultra RNA Library Prep Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Mitochondrial respiration in live MSCs were measured using seahorse XF24 Extracellular Flux Analyzer with Mito stress test kit according to manufacturer’s protocol (Agilent). In brief ...
-
bioRxiv - Microbiology 2020Quote: Electrophoretic analyses were performed on the TapeStation 4500 (D1000 Screen Tape and D1000 Reagents kits; all from Agilent Technologies) or by horizontal electrophoresis using a 2% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragment size of the final libraries was determined using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, CA, USA). Their concentration was determined using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... were introduced into the BG505 SOSIP.v5.2 pPPI4 vector 53 using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). The R500A and Q658K mutations were added to the BG505 SOSIP.v5.2.N241.N289 vector ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA integrity was assessed using Agilent’s Eukaryotic Total RNA 6000 Nano Kit on an Agilent 2100 BioAnalyzer (Agilent Technologies), and the concentration was subsequently measured using the Qubit RNA HS assay (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality was assessed using 2100 Bioanalyzer G2938C using an Agilent RNA 6000 Nano Kit (Agilent; Cat # 5067-1511) and Qubit 4 Fluorometer (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Developmental Biology 2022Quote: ... The average length distribution of the fragmented cDNA libraries was assessed by the high sensitivity DNA kit (Agilent, USA) and the libraries quantified by Qubit (Thermo Scientific ...
-
bioRxiv - Genomics 2022Quote: ... while library quality checks were performed using an Agilent 2100 Bioanalyzer and High Sensitivity DNA Kit (Agilent Technologies Ltd.). Individually barcoded RNA-seq libraries were pooled in equimolar quantities and the quantity and quality of the final pooled libraries (two different pools in total ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... All samples were quantified by a Bioanalyzer using the Agilent RNA 6000 Nano Kit reagents and protocol (Agilent Technologies). Only RNA samples with RNA Integrity Number (RIN ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Evolutionary Biology 2022Quote: ... PKR site-specific mutants and epteK3Δ227-508 were generated by PCR mutagenesis using the QuickChange Lightning mutagenesis kit (Agilent) and primers holding the desired mutations/deletions ...
-
bioRxiv - Genomics 2022Quote: ... Individually indexed IgG and IgM libraries were assessed using the Agilent 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). All the libraries were sequenced on NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... A928V and TYK2-ΔE8 were generated by site-directed mutagenesis using QuickChange XL site-directed mutagenesis kit (Agilent Technologies) in pRc-TYK2 or pQE-His-N [22] ...
-
bioRxiv - Bioengineering 2019Quote: ... RNA integrity was assessed using the RNA Nano 6000 assay kit and the Agilent Bioanalyzer 2100 system (Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Cell Biology 2019Quote: ... Amplified cDNA and final libraries were evaluated on a Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Individual libraries were diluted to 4nM and pooled for sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quantity and quality was measured using an Agilent 2100 Bioanalyzer with the 6000 Pico Kit (Agilent, 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was performed according to the manufacturer’s instructions of QuikChange® Site-Directed Mutagenesis Kit (Agilent Technologies). The reactions were conducted using as template the plasmid pET28a-XfybbN and pET15b-EcYbbN ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... we undertook massively parallel sequencing using a solution-phase SureSelect hybrid capture kit (Agilent Technologies, Santa Clara, CA, USA) and an HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Immunology 2019Quote: ... MG505.A3 or MG505.H3) was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... thermophilus GyrB overexpression 12 was mutated by site directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent) in order to generate two plasmids harboring K284R or K284Q mutations ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Site-directed mutagenesis of BenM in pMeLS0076 was carried out using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... pME-hB3GALT4-3HA was used as a template and mutagenized by a commercial site-directed mutagenesis kit (Agilent Technologies). UGCG mutant plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... Synthesis of cDNA was carried out using the AffinityScript qPCR cDNA Synthesis Kit and random primers (Agilent Technologies, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The average size and concentration of all libraries were analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) followed by qPCR quantification using SensiMix SYBR (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent, La Jolla, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... the parental Env-encoding plasmid was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mutant ORFs (FGFR2 M538I, N550K and K660N) were made using QuickChange II site-directed mutagenesis kit (Agilent Technologies #200523). Most stable cells lines express ORFs in pLX317 vector and were selected with puromycin (Life Technologies #A1113803) ...
-
bioRxiv - Cell Biology 2020Quote: ... P190RhoGAP-A mutants were produced through PCR-based site-directed mutagenesis using the Quikchange kit (Stratagene, San Diego, CA). For the Y1087F mutation ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Calibration was performed using PEG standards of molecular weights up to 300,000 MW (Agilent PEG calibration kit, Agilent Technologies). Molecular weight and dispersity values were calculated using LabSolutions GPC software (Shimadzu Europa GmbH) ...
-
bioRxiv - Genetics 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Isolated RNAs were preserved on the condition of −80°C until reverse transcription.
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified cDNA and final libraries were evaluated on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Libraries were sequenced with PE100 on the DNBSEQTM NGS technology platform (BGI ...
-
bioRxiv - Zoology 2021Quote: ... and quality control of the libraries was implemented using Bioanalyzer 2100 instrument and the DNA High Sensitivity kit (Agilent). Sequencing was performed on an Illumina HiSeq 4000 system ...
-
bioRxiv - Plant Biology 2020Quote: ... deletions or insertions in WHIRLY coding sequences the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) was used according to the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... Quality and concentration of libraries from individual samples were assessed using the High Sensitivity dsDNA kit (Agilent, 067-4626) on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified PCR products were quantified using Agilent Bioanalyzer 2100 Instrument using the High sensitivity DNA Kit (Agilent, 5067-4626). Ion Torrent Emulsion PCR and enrichment steps were performed using Ion PGM HiQ View OT2 kit (Life technologies ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cryopreserved tumour samples or cultured cells using the Total RNA Isolation Micro kit (Agilent) and cDNA then synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miR159 recognition site was altered by directed mutagenesis using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies); the amino acid sequence was not changed ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was assessed using the Agilent RNA 6000 pico kit on an Agilent 2100 Bioanalyzer (Agilent Technologies, USA); only replicates where all samples had an RNA integrity number (RIN ...