Labshake search
Citations for Agilent :
6101 - 6150 of 8383 citations for Human Uromodulin Like 1 UMODL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... MCS to generate pGEMT-EZ-Sph-UPF1-FLAG-Sac.The UPF1-Xho-Sph gene fragment in plasmid vector pQ (Quintarabio) was mutagenized with oligonucleotides 5Upf1C62Ymut and 3Upf1C62Ymut using the QuikChange II XL site directed mutagenesis kit (Agilent). The UPF1XhoI-C62Y-SphI fragment was isolated and ligated with the 2.28 kb Sph-UPF1-FLAG-Sac fragment from pGEMT-EZ-Sph-UPF1-FLAG-Sac into the XhoI-SacI site of the MCS of pRS425.
-
bioRxiv - Microbiology 2020Quote: Site directed mutagenesis was performed on pGAPZα-His-MspGH25 vector according to the instructions of the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis was carried out according to the manufacturer’s instructions for the QuikChange II site-directed mutagenesis kit (Agilent Technologies), or by PCR-overlap extension (Ho et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies, Cheshire, UK) and measured with an Agilent Bioanalyser ...
-
bioRxiv - Microbiology 2020Quote: ... Expression vectors encoding the six different mutants of HIV-2 Env cytoplasmic tail were created by introducing stop codon in different position within the cytoplasmic tail by site-directed mutagenesis using the QuickChange II Site-Directed Mutagenesis Kit (Agilent). HIV-2 Env mutants were as follows ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA quantity and purity were analysed using a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA), all samples had RIN numbers >7.0 ...
-
bioRxiv - Microbiology 2020Quote: ... 2009) was created by site-directed mutagenesis of pHT304-Pxyl-mogR using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene) and primers 5’-tccaaaaacagaaagtcaattggcagctacgtattataaattgaaaaaacgtg-3’ and 5’-cacgttttttcaatttataatacgtagctgccaattgactttctgtttttgga-3’ (mutated bases underlined) ...
-
bioRxiv - Molecular Biology 2021Quote: All the mutants used in this study were generated by site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis kit (Stratagene).
-
bioRxiv - Molecular Biology 2021Quote: ... A targeted mutation in the Nudix motif was introduced through use of the QuikChange site-directed mutagenesis kit (Agilent Technologies) to produce a plasmid encoding L375 (E258Q).
-
bioRxiv - Immunology 2020Quote: ... with 1 μL used to check the expected size (~300 bp) and the samples’ purity were verified with the Agilent High Sensitivity DNA Kit as manufacturer’s recommendation (Agilent Technologies). One μL of the diluted libraries were used to quantify as recommended in the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 1μl of each sample was used for quality and concentration analysis on a 2100 Bioanalyzer using the RNA 6000 Nano kit (Agilent). 500ng of RNA was used to prepare each mRNA library ...
-
bioRxiv - Immunology 2021Quote: ... The D614G mutation was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genomics 2019Quote: ... 1uL of 15uL total from each sample was subjected to Agilent Bioanalyzer analysis using the Total Eukaryotic RNA Pico kit (Agilent). All samples demonstrated significant enrichment of Sox9 across EGFP population and had RIN values ≥ 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... RUVBL2 and siRNA-resistant RUVBL2 ATPase mutant (E300G) were constructed by site-directed mutagenesis of Flag-TIP49b (RUVBL2) using QuikChange site-directed mutagenesis kit (Agilent). His-NFAT5171-250-AcGFP ...
-
bioRxiv - Genomics 2021Quote: ... Integrity was assessed using Agilent RNA 6000 Nano Kit on a 2100 Bioanalyzer instrument (Agilent Technologies, Santa Clara, CA, USA). The RIN score and the percentages of fragments larger than 200 nucleotides (DV200 ...
-
bioRxiv - Genomics 2020Quote: ... 10X-barcoded full-length cDNA was then amplified via PCR and analyzed using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent). Up to 50 ng of cDNA was carried over to construct gene expression libraries and was enzymatically fragmented and size-selected to optimize the cDNA amplicon size prior to 5’ gene expression library construction ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutagenesis of the A2REs in the Ins1 5’-UTR was performed with the QuikChange II Site-directed mutagenesis kit (Agilent). Cells were co-transfected with each pNL1.1 construct and the pGL4.54 for normalization ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... the ChT swapping mutants using fusion PCR and the point mutations using site-directed mutagenesis by a QuikChangeII kit (Agilent) with the primers listed in supplemental information (Table S1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The different KlGAL80 alleles were generated by site-directed mutagenesis using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) or by fusion PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The different GAL80 alleles were generated by site-directed mutagenesis using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) or by fusion PCR ...
-
bioRxiv - Immunology 2021Quote: ... Precise measurements of glycolysis in ILC2s were carried out using the Seahorse XF Glycolytic Rate Assay Kit (Agilent; 103344-100) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Average library molecular size was determined using the DNA High Sensitivity Assay kit with the Agilent 2100 Bioanalyzer (Agilent Technologies). The Library was then used to generate paired end reads over 150 cycles at the UC Davis DNA Sequencing Technologies Core facility on the Illumina HiSeq 4000 system.
-
bioRxiv - Microbiology 2021Quote: ... and average fragment size of each sample was assessed using an Agilent 2100 Bioanalyzer system and RNA 6000 Nano kit (Agilent) prior to sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... conversion of both the pre TM1 and the TM2-TM3 loop from the chimera to the corresponding α9 sequence was performed by QuikChange Multi Site-Directed Mutagenesis kit (Stratagene) using primers 5’GGCATGCTCTCGGCCACCATCAGCTGGAAGACGG3’ and 5’GGGCAGCAGGAGGTTGACGATGTAGAATGAAGAGCGGCGCTTCAG3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies) and quantified using the KAPA Library Quantification Kit for Illumina (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using a Qubit RNA assay kit and checked for quality using a High Sensitivity RNA ScreenTape on a TapesStation (Agilent). RNA integrity scores are typically 7.0 and greater ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... the RIN (RNA integrity number) value of RNA isolated from tissue culture was determined using the Agilent RNA 6000 Pico Kit (#5067-1513 Agilent) with a 2100 Bioanalyzer (#G2939BA Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were verified on an Agilent 2100 bioanalyzer with a High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for the average fragment length calculation and evaluation of quality and on Qubit 2.0 ...
-
bioRxiv - Biochemistry 2022Quote: Human ALDH9A1 mutants were generated from the template plasmid (EX-Z3075-M29) described above using a QuickChange XL II Site-Directed Mutagenesis Kit (Agilent). Primers were designed with the corresponding mutations as prescribed by the QuickChange Primer Design tool (https://www.agilent.com/store/primerDesignProgram.jsp ...
-
bioRxiv - Cancer Biology 2022Quote: ... cleaned by a 0.6X AMPure XP bead cleanup and quantified on a 2100 Bioanalyzer Instrument following the manufacturer’s protocol “Agilent High Sensitivity DNA Kit” (G2938-90321, Agilent Technologies). This procedure was done twice for every fraction selected ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA quantification was performed using the Agilent Bioanalyzer High Sensitivity Kit on an Agilent Bioanalyzer 2100 (Agilent Technologies, CA, USA). cDNA libraries were sequenced on an Illumina NovaSeq 6000 sequencer using the SP flowcell (200 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-sequencing was performed according to the standard protocol of Novogene Corporation Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... All four Single Cell 3’ Gene Expression libraries were quantified on a 2100 Bioanalyzer Instrument following the manufacturer’s protocol “Agilent DNA 7500 kit” (G2938-90024, Agilent Technologies). These Single Cell 3’ Gene Expression libraries were combined to create one sequence library pool which was quantified by qPCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... The stranded mRNA libraries were analyzed on a 2100 Bioanalyzer instrument following the manufacturer’s protocol “Agilent DNA 7500 kit” (G2938-90024, Agilent Technologies), diluted to 10nM and pooled equimolar into multiplex sequencing pools for sequencing on the HiSeq 2500 and NovaSeq 6000 Illumina sequencing platforms ...
-
bioRxiv - Cancer Biology 2022Quote: ... All K-Ras secondary mutant and wild-type K-Ras constructs were generated by a PCR based strategy using a site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... incapable of binding DNA was generated by introducing point mutations into the pENTR-Nr2f6 construct using a QuikChange II XL Site Directed Mutagenesis Kit (Agilent), and the inserts were subsequently cloned into pLX304 (lentiviral ...
-
bioRxiv - Cancer Biology 2022Quote: ... All stainings were performed using the DAKO Link 48 Autostainer Platform and the EnVision FLEX Visualization kit (DAKO, cat# K8002) according to standard diagnostic routine protocols and manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome sequencing was performed by Macrogen Inc (Seoul, South Korea) or BGI (Shenzhen, China) with SureSelect V5 Exome Capture Kit (Agilent) and sequencing on Illumina HiSeq ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations into the TMD were introduced by site-directed mutagenesis using the Quick Change II kit following the manufacturer’s instructions (Agilent Technologies). All DNA manipulations were confirmed by the sequencing of plasmid DNAs (Macrogen Spain) ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis of POLID was performed on pTOPO-FLID-WT using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with primers POLID M1 and POLID M2 to generate pTOPO-FLID-Poldead ...
-
bioRxiv - Cell Biology 2022Quote: ... The stop codon between MYO10 and BioID was then replaced with a codon encoding valine (GTA) using a quick-change mutagenesis kit from Agilent and following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... sor1-D303A and sor1-Y305A variants proteins) were introduced into the cloned sor1 gene using the QuikChangeII kit (Agilent Technologies) and inserted into the genome by transformation.
-
bioRxiv - Cell Biology 2022Quote: ... The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA) substitutions using the Quick-Change kit (Agilent) using primers indicated in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... losing nuclear localization was generated by mutating the lysine residues at 472 and 473 to alanine residues (KK472/473AA) via the QuickChange site-directed mutagenesis kit (Stratagene). The same approach was used to generate tyrosine phospho-defective PFKFB3 at the indicated residues by replacing tyrosine with phenylalanine ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: The PSMB7 mutant gene library was previously generated (Kachroo et al, 2015) by error-prone PCR (GeneMorph II Random Mutagenesis Kit from Agilent) to introduce mutations and add attL1 and attL2 sites at the 5’ and 3’ ends of the gene (Reece-Hoyes & Walhout ...
-
bioRxiv - Genomics 2022Quote: ... RNA quality was assessed by resolving the 18S and 28S ribosomal RNA bands using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent). RNA-seq libraries were constructed using TruSeq Stranded Total RNA sample prep kit (Illumina) ...