Labshake search
Citations for Agilent :
5901 - 5950 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... GPx7 and GPx8 Cys-Ala mutants were constructed by using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies).
-
bioRxiv - Biochemistry 2020Quote: All mutations in C100 FLAG were introduced by site-directed mutagenesis (QuickChange Lightning Site Directed Mutagenesis kit, Agilent) in pET 22b vector ...
-
bioRxiv - Neuroscience 2021Quote: ... Missense mutations were introduced by site-directed mutagenesis using the Quik-Change II site-directed mutagenesis kit (Agilent) and mutagenic oligonucleotides obtained from Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No. DNF-915, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2020Quote: ... Site-directed mutagenesis in the PH-COOH background was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) or the Q5 Site-Directed Mutagenesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutagenesis of individual amino acid residues in KRaION1 was done using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Forward and reverse primers used to generate each mutant are provided in Supplementary Table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... S27 isolate-based plasmid via site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The following mutations were introduced ...
-
bioRxiv - Microbiology 2020Quote: ... and Sialic acids from the purified S-Ectodomain was performed by using a Deglycosylation kit (Agilent, CA, USA) as per the manufacturer instructions ...
-
bioRxiv - Plant Biology 2020Quote: The mutated variants were achieved by site-directed mutagenesis using the Multi-Directed Mutagenesis Kit (Agilent Technologies: California) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Site-directed mutagenesis of PpKAI2L-H was performed using the QuickChange II XL Site Directed Mutagenesis kit (Stratagene), performed on pGEX-4T-3-PpKAI2L-H (see Supplementary Table 1 for primers) ...
-
bioRxiv - Microbiology 2020Quote: ... and library quality was checked using the High Sensitivity DNA LabChip Kit on the Bioanalyzer 2100 (Agilent Technologies). Sequencing clusters were generated using the MiSeq reagents kit v2 500 cycles (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... and library quality was checked using the High Sensitivity DNA LabChip Kit on the Bioanalyzer 2100 (Agilent Technologies). Sequencing clusters were generated using the MiSeq reagents kit v2 500 cycles (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... the adapter-ligated/RT primer mixture was used as template with the AffinityScript cDNA Synthesis Kit (Agilent, 600559) with the following reaction conditions ...
-
bioRxiv - Systems Biology 2020Quote: Five itpr residues in Drosophila itpr cDNA (Sinha & Hasan, 1999) were mutated using site directed mutagenesis kit (Agilent). The oligonucleotide CAGAGATCGGCAGCAATTGCTGCAGGAACAGTACATCC was used to change K530/R533 to Q while GTACCACGTCTTTCTGCAGACCACCGGACGCACCAG was used to change R272 to Q ...
-
bioRxiv - Microbiology 2020Quote: ... VSGsur mutants N130A and H122A were generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was eluted by adding 100 μl Lysis Buffer and purified using the Absolutely RNA Nanoprep Kit (Agilent). cDNA was prepared with the Ovation RNA-seq V2 kit (Nugen ...
-
bioRxiv - Biophysics 2021Quote: ... were pooled together and used to perform multisite mutagenesis using the QuikChange Multi site-directed mutagenesis kit (Agilent). Due to imperfect reaction efficiency ...
-
bioRxiv - Microbiology 2021Quote: ... The final library size and quality was evaluated using an Agilent High Sensitivity DNA Kit (Agilent Technologies, CA), and the fragments were found to be between 250 and 350 bp in size ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was then assessed on an Agilent Bioanalyzer and the RNA 6000 Pico Kit (Agilent 5067-1513). PolyA RNA was isolated using the NEBNext Poly(A ...
-
Fruitless decommissions regulatory elements to implement cell-type-specific neuronal masculinizationbioRxiv - Neuroscience 2020Quote: The quality of prepared libraries was verified with a Bioanalyzer 2100 using a high sensitivity DNA kit (Agilent). Libraries were quantified using KAPA qPCR assay (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were quality controlled using the Bioanalyzer High Sensitivity DNA Analysis Kit and the Agilent 2100 Bioanalyzer (Agilent). All samples were prepared and sequenced in technical replicate ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... All mutations listed in Supplemental Table 2 were introduced using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with appropriate mutagenic primers ...
-
bioRxiv - Plant Biology 2019Quote: ... was used as a template for cDNA synthesis with the Affinity Script QPCR cDNA Synthesis Kit (Agilent Technologies). RT-qPCR and data analysis were performed as described in [75] ...
-
bioRxiv - Microbiology 2021Quote: The NdeI site within the TbFUT1 sequence was eliminated using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) and primers P24/P25 ...
-
bioRxiv - Microbiology 2020Quote: ... and rRNA removal efficiency was then analyzed via the Agilent 2100 Bioanalyzer RNA 6000 Pico kit (Agilent Technologies). Library preparation for sequencing on the Illumina HiSeq platform was completed using the TruSeq stranded mRNA HT library preparation kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... RNA quality was measured using the Agilent 2100 Bioanalyzer RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA) and all RNA samples utilized for downstream RNAseq library preparation had an RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations were introduced using standard PCR or using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, 210515). Double A3H fusion constructs I-I ...
-
bioRxiv - Microbiology 2020Quote: ... R134A and E321N) were incorporated into the gene sequence using the QuickChange XL site-directed mutagenesis kit (Stratagene), along with a set of several primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sample integrity was evaluated using the Agilent Bioanalyzer RNA Nano and Pico kits (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Cell Biology 2020Quote: ... we performed the mitochondrial stress test using the Seahorse Mito-stress test kit (part nb 103015-100, Agilent) with a final concentration of 4mM Oligomycin ...
-
bioRxiv - Cell Biology 2020Quote: ... Site-directed mutagenesis with a Stratagene QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Inc. Santa Clara, CA) was used to generate pom152Y180L,Q182L-GFP (pKBB553 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was amplified and labeled with the Low Input Quick-Amp Labeling Kit (Agilent Technologies, # 5190-2305). In brief ...
-
bioRxiv - Genetics 2022Quote: ... and its quality was assessed using a 2100 Bioanalyzer Expert system using a total RNA nano Kit (Agilent), all samples displayed an RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... IN mutations were introduced in the pLR2P-VprIN plasmid using the QuikChange Site- Directed Mutagenesis kit (Agilent Technologies). The presence of the desired mutations and the absence of unwanted secondary changes was assessed by Sanger sequencing.
-
bioRxiv - Immunology 2022Quote: ... MARS-seq barcoded RT primers were used for reverse transcription with the Affinity Script cDNA Synthesis Kit (Agilent) in a 10 μl reaction volume.
-
bioRxiv - Neuroscience 2022Quote: ... All RNA samples were validated for high quality using Bioanalyzer RNA 6000 Pico Kit (Agilent, San Diego, CA). 1 ng of total RNA was used to generate full length cDNA using Clontech’s SMART-Seq v4 Ultra Low Input RNA Kit ...
-
bioRxiv - Genomics 2022Quote: ... cDNA and library quality were determined using the High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent Technologies). Multiplexed RNA-seq libraries were sequenced as paired end 150 runs on a NextSeq 500 to a sequencing depth of ~5 million read pairs.
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... tuberculosis RNA was accomplished using One-Color Microarray-Based Low Input Quick Amp WT Labelling kit (Agilent Technologies) as per the manufacturer’s protocol using 300ng of input RNA ...
-
bioRxiv - Cell Biology 2022Quote: Emerin mutants were generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies; Santa Clara, CA) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA quality was assessed on a bioanalyzer using the Agilent RNA 6000 Nano kit (5067-1511; Agilent Technologies); 0.2-1 μg of RNA with RNA integrity number > 7 proceeded for library preparation using an Illumina TruSeq RNA prep kit ...
-
bioRxiv - Immunology 2022Quote: ... L452R and E484Q for the κ variant) were introduced using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and samples were run on a fragment analyzer by using the High Sensitivity NGS Fragment Analysis Kit (Agilent) to define the size of cfDNA extracted and genomic DNA contamination ...
-
bioRxiv - Cell Biology 2022Quote: ... the stop codon was first mutagenized to glycine using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with the STOP-to-glycine primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... size profiles examined in the Bioanalyzer using the DNA High Sensitivity DNA Kit (Agilent, Part No. 5067-4626). Samples were pooled and sequenced in a NovaSeq by Novogene (Cambridge ...
-
bioRxiv - Cancer Biology 2022Quote: ... the quantity and purity were measured with Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutagenesis was performed using the QuikChange Lightning Multi site directed mutagenesis kit (Agilent, Santa Clara, USA, Cat#210513) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Removal efficiency of rRNA was confirmed using an Agilent 2100 Bioanalyzer system and RNA 6000 Nano kit (Agilent). Enriched mRNA samples were then used for RNA sequencing using an Illumina NextSeq ...
-
bioRxiv - Microbiology 2021Quote: ... for correct size and purity with the NGS standard sensitivity fragment analysis kit (Agilent Cat. No. DF-473). Of all suitable samples a pool of 2 nM was generated and loaded to the Illumina MySeq 2500 system.
-
bioRxiv - Developmental Biology 2020Quote: ... product size distribution and quantity were assessed on a Bioanalyzer using a High Sensitivity DNA Kit (Agilent Technologies). A total of 140 pg of the amplified cDNA was fragmented using Nextera XT (Illumina ...