Labshake search
Citations for Agilent :
5851 - 5900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and incubating it at 95 °C for 23 min using a pt link pretreatment system (Dako, Agilent, Glostrup, Denmark). We removed the staining container at room temperature and allowed the slides to cool for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... all tissue section slides were treated with a mouse monoclonal Anti-Human IgG p27KIP1 (Clone SX53G8.5 dilution 1:100; Code M7203; Dako Cytomation, Denmark) that cross-reacts with p27kip1 using a protocol described previously [24] ...
-
bioRxiv - Microbiology 2023Quote: ... The detection was carried out using Dako EnVision®+ Dual Link System-HRP (DAB+) (Dako, Agilent). The Liquid DAB+ Substrate Chromogen System (Dako ...
-
bioRxiv - Microbiology 2023Quote: ... The Liquid DAB+ Substrate Chromogen System (Dako, Agilent) was used to view the slides ...
-
bioRxiv - Microbiology 2023Quote: ... All the slides were treated with p27 monoclonal antibody (H-1): sx-53G8.5 (Dako Cytomation, Agilent), diluted 1:100 in Dako antibody diluent ...
-
bioRxiv - Microbiology 2023Quote: ... All the slides were treated with p27 monoclonal antibody (H-1): sx-53G8.5 (Dako Cytomation, Agilent), diluted 1:100 in Dako antibody diluent ...
-
bioRxiv - Microbiology 2023Quote: ... The Liquid DAB+ Substrate Chromogen System (Dako, Agilent) was used to view the slides ...
-
bioRxiv - Neuroscience 2023Quote: All in vivo magnetic resonance (MR) experiments were conducted on a 14.1 Tesla vertical MR system (Agilent Technologies, Palo-Alto, CA, USA) equipped with 100G/cm gradients and a single tuned millipede 1H proton coil (ØI = 40mm) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (GFAP anti-mouse Dako M0761 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN anti-mouse EMD Millipore MAB377, GFAP anti-mouse, PSD-95 anti-rabbit abcam ab18258, S100B anti-rabbit Dako Z0311, SYT-1 anti-goat LSBio LS-B5899), secondary antibodies (488 anti-mouse ...
-
bioRxiv - Neuroscience 2023Quote: ... MAPT (Dako, A0024), phospho-MAPT (Thr231 ...
-
bioRxiv - Neuroscience 2023Quote: ... Quality and size of RNA-Seq libraries were assessed by capillary electrophoretic analysis with the Agilent 4200 Tape station (Agilent Technologies). Libraries were quantified by real-time PCR against a standard curve with the KAPA Library Quantification Kit (KapaBiosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA integrity was assessed using the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies). All samples showed an RNA integrity number (RIN)>9 ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were mounted on a slide glass with the mounting reagent (DAKO glycerol mounting medium) using #1.5 coverslips.
-
bioRxiv - Neuroscience 2023Quote: ... followed by addition of AarI restriction sites via site directed mutagenesis (Agilent) to enable insertion of gfp sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 mM NH4HCO3 pH 8 and fractionated in a basic pH reversed phase chromatography using a HPLC equipped with a 3.5 μm Zorbax 300 Extended-C18 column (Agilent). Fractions were collected in a 96-well plate ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-ubiquitin (1:2000; rabbit; Dako), anti-GFP (ab290 ...
-
bioRxiv - Neuroscience 2023Quote: ... were determined with the Agilent 2100 Bioanalyzer system using the Eukaryotic Total RNA Pico Chips and the 2100 Expert software (Agilent, Santa Clara, CA, USA). To obtain enough RNA for this test ...
-
bioRxiv - Neuroscience 2023Quote: ... and paraffin embedded before sectioning at 3,5-µm thickness onto DAKO IHC Flex tissue slides (DAKO Aps, Glostrup, Denmark). Sections were deparaffinized in a xylene and alcohol gradient and subjected to antigen retrieval in Tris-EDTA buffer (pH 9.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were mounted DPX or fluorescent mounting medium containing DAPI (DAKO Agilent, Glostrup, Denmark).
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity was checked with the Bionalyzer (agilent 2100 Bioanalyzer, Agilent RNA 6000 nano kit). Five ng of mRNA from each sample were used for retro-transcription ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity was assessed with Nanodrop Spectrophotometer (Nanodrop Technologies) and quality with the Agilent Bioanalyzer (Agilent Technologies). As per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA integrity was checked by an Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were validated on an Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified using a Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 2100 Bioanalyzer instrument (Agilent, Cat# G2939BA), with RIN ranging between 2.0 and 5.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Quality of purified RNA was confirmed using the 6000 RNA Pico kit (Agilent, Cat# 5067-1513) in a 2100 Bioanalyzer instrument (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... All point mutations of plasmids were generated by Quick Change PCR mutagenesis using Pfu Ultra polymerase (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Neuroscience 2023Quote: ... and processed with 2100 Bioanalyzer system (Agilent technology).
-
bioRxiv - Neuroscience 2023Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 megabase pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq 4,000 (sx75 base-pair paired-end configuration ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were then run on the Agilent 2100 Bioanalyzer (Agilent Technologies) for quantification and quality control and pair-end sequenced on the Illumina NovaSeq platform.
-
bioRxiv - Immunology 2023Quote: ... Membranes were detected with peroxidase conjugated secondary antibodies (Agilent Technologies, California, USA) and developed by ECL (Amersham Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies). 0.5-1 μg were used to prepare libraries for RNA-seq with the Illumina TruSeq RNA Library Prep Kit v2 following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured with an XF96 extracellular flux analyzer (Seahorse Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA quality was first controlled with TapeStation (Agilent D1000), then the processed with SMART-Seq v4 Ultra Low Input RNA kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The DNA size distributions were assessed at each relevant step by capillary pulse-field electrophoresis with the FemtoPulse system (Agilent, M5330AA and FP-1002-0275). 4-10 μg of gDNA were either fragmented to a size of 10-50kb with the Megaruptor 3 (Diagenode ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 μm (Agilent, California, USA). Flow rate ...
-
bioRxiv - Cancer Biology 2023Quote: ... PD-L1 (clone 22C3; Dako; 1:150). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA samples were quantified and quality-checked by 280 nm absorbance and TapeStation gel electrophoresis (Agilent) before use ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA concentration and RNA integrity number (RIN) were determined using an Agilent microfluidic RNA 6000 Nano Chip kit (Agilent Technologies, Santa Clara, CA) on the 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... on the 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Those samples with RIN greater than 9 were used for RNAseq ...
-
bioRxiv - Cancer Biology 2023Quote: RNA quality was assessed using a TapeStation system (Agilent), and all samples received a RIN score >6 before bulk RNA sequencing analysis ...
-
bioRxiv - Cancer Biology 2023Quote: The LC-MS analysis was performed on an LC-MS system (Agilent InfinityLab LC/MSD iQ) with a Poroshell 120 SB-C18 column ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Immunology 2023Quote: ... Final library quantity was measured using the KAPA SYBR® FAST qPCR and library quality evaluated using a TapeStation D1000 ScreenTape (Agilent Technologies, CA, USA). Final library size was about 450bp with an insert size of about 300bp ...
-
bioRxiv - Immunology 2023Quote: ... Library concentration and purity were measured using a high-sensitivity DNA Bioanalyzer chip (Agilent Technologies, Santa Clara, CA). Paired-end sequencing was performed on an Illumina HiSeq 2000 instrument (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% medronic acid (Agilent), and Mobile phase B contained 90% acetonitrile and 0.1% medronic acid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Data were collected and analysed using the Wave 2.6 software (Agilent Technologies), with calculations of ATP production rates by mitochondrial respiration (J-ATPox ...
-
bioRxiv - Immunology 2023Quote: ... Sample quality assessment was performed on a Fragment Analyzer electrophoresis system (Agilent). Total RNA was normalized prior to oligo-dT capture and cDNA synthesis with SMART-Seq v4 (Takara) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).