Labshake search
Citations for Agilent :
5651 - 5700 of 8653 citations for Rat Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... A928V and TYK2-ΔE8 were generated by site-directed mutagenesis using QuickChange XL site-directed mutagenesis kit (Agilent Technologies) in pRc-TYK2 or pQE-His-N [22] ...
-
bioRxiv - Bioengineering 2019Quote: ... RNA integrity was assessed using the RNA Nano 6000 assay kit and the Agilent Bioanalyzer 2100 system (Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Cell Biology 2019Quote: ... Amplified cDNA and final libraries were evaluated on a Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Individual libraries were diluted to 4nM and pooled for sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quantity and quality was measured using an Agilent 2100 Bioanalyzer with the 6000 Pico Kit (Agilent, 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was performed according to the manufacturer’s instructions of QuikChange® Site-Directed Mutagenesis Kit (Agilent Technologies). The reactions were conducted using as template the plasmid pET28a-XfybbN and pET15b-EcYbbN ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... we undertook massively parallel sequencing using a solution-phase SureSelect hybrid capture kit (Agilent Technologies, Santa Clara, CA, USA) and an HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Immunology 2019Quote: ... MG505.A3 or MG505.H3) was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... thermophilus GyrB overexpression 12 was mutated by site directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent) in order to generate two plasmids harboring K284R or K284Q mutations ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Site-directed mutagenesis of BenM in pMeLS0076 was carried out using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... pME-hB3GALT4-3HA was used as a template and mutagenized by a commercial site-directed mutagenesis kit (Agilent Technologies). UGCG mutant plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... Synthesis of cDNA was carried out using the AffinityScript qPCR cDNA Synthesis Kit and random primers (Agilent Technologies, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The average size and concentration of all libraries were analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) followed by qPCR quantification using SensiMix SYBR (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent, La Jolla, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... the parental Env-encoding plasmid was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mutant ORFs (FGFR2 M538I, N550K and K660N) were made using QuickChange II site-directed mutagenesis kit (Agilent Technologies #200523). Most stable cells lines express ORFs in pLX317 vector and were selected with puromycin (Life Technologies #A1113803) ...
-
bioRxiv - Cell Biology 2020Quote: ... P190RhoGAP-A mutants were produced through PCR-based site-directed mutagenesis using the Quikchange kit (Stratagene, San Diego, CA). For the Y1087F mutation ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Calibration was performed using PEG standards of molecular weights up to 300,000 MW (Agilent PEG calibration kit, Agilent Technologies). Molecular weight and dispersity values were calculated using LabSolutions GPC software (Shimadzu Europa GmbH) ...
-
bioRxiv - Genetics 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Isolated RNAs were preserved on the condition of −80°C until reverse transcription.
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified cDNA and final libraries were evaluated on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Libraries were sequenced with PE100 on the DNBSEQTM NGS technology platform (BGI ...
-
bioRxiv - Zoology 2021Quote: ... and quality control of the libraries was implemented using Bioanalyzer 2100 instrument and the DNA High Sensitivity kit (Agilent). Sequencing was performed on an Illumina HiSeq 4000 system ...
-
bioRxiv - Plant Biology 2020Quote: ... deletions or insertions in WHIRLY coding sequences the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) was used according to the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... Quality and concentration of libraries from individual samples were assessed using the High Sensitivity dsDNA kit (Agilent, 067-4626) on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified PCR products were quantified using Agilent Bioanalyzer 2100 Instrument using the High sensitivity DNA Kit (Agilent, 5067-4626). Ion Torrent Emulsion PCR and enrichment steps were performed using Ion PGM HiQ View OT2 kit (Life technologies ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cryopreserved tumour samples or cultured cells using the Total RNA Isolation Micro kit (Agilent) and cDNA then synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miR159 recognition site was altered by directed mutagenesis using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies); the amino acid sequence was not changed ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was assessed using the Agilent RNA 6000 pico kit on an Agilent 2100 Bioanalyzer (Agilent Technologies, USA); only replicates where all samples had an RNA integrity number (RIN ...
-
bioRxiv - Systems Biology 2020Quote: ... and centrifuged again to remove the supernatant.RNA was then extracted from the isolated disc cells using Absolutely RNA Nanoprep Kit (Stratagene), following manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... as well as size and concentration assessment with a 2100 Bioanalyzer and the Agilent DNA 1000 Kit (Agilent Technologies). We also extracted gDNA from the two sperm samples as described by Hammoud and colleagues [4] ...
-
bioRxiv - Genomics 2019Quote: ... RNA quality and quantity were respectively assessed using Agilent RNA 6000 Pico kit on Agilent 2100 Bioanalyzer (Agilent Technologies) and Qubit RNA HS assay kit on Qubit 3.0 Fluorometer (Thermo Fischer Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... in plasmid containing LshCas13a locus and a CRISPR array carrying a spacer targeting RFP mRNA (pC003_RFP1) using QuikChange Site-Directed Mutagenesis kit (Agilent) and the mutagenic primers containing the desired mutations (Supplementary Table 2 ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP, Dako, Glostrup, Denmark), as secondary antibody ...
-
bioRxiv - Plant Biology 2019Quote: ... The phosphomimetic substitutions were introduced using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA). Resulting entry vectors were transferred into pGWB550(4 ...
-
bioRxiv - Genomics 2019Quote: ... and RNA quality was verified using RNA 6000 Nano kits on an Agilent 2100 Bioanalyzer (Agilent Technologies, Mississauga, ON). RNA abundance levels were assayed using Affymetrix Mouse Gene 1.1 ST arrays (Affymetrix Mouse Gene 2.0 ST arrays were used for the C57BL/6 mice for EXP1 ...
-
bioRxiv - Epidemiology 2019Quote: ... The average size of the library was determined by the Agilent High Sensitivity DNA Kit (Agilent, Santa Clara, CA). An accurate library quantification was determined using the Library Quantification Kit – Illumina/Universal Kit (KAPA Biosystems ...
-
bioRxiv - Systems Biology 2019Quote: ... Quality of the DNA sample was checked by running Agilent High Sensitivity DNA Kit using Agilent 2100 Bioanalyzer (Agilent) before sequenced using HiSeq 2500 (Illumina ...
-
bioRxiv - Plant Biology 2019Quote: ... The quality and quantity of each library were determined using a Bioanalyzer with High Sensitivity DNA kit (Agilent Technologies), and KAPA Library Quantification Kit for Illumina (Illumina) ...
-
bioRxiv - Developmental Biology 2019Quote: The exonic sequences were captured with the Agilent Sure Select All Exon v4 kit (Agilent, Santa Clara, CA, USA) and sequencing was performed on an Illumina HiSeq2000 sequencing apparatus (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... Serine-to-alanine mutation was generated using QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA 200522) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... and AFF4 NM_014423.4:c.772C>T mutations were engineered using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... coli were generated by introducing the corresponding mutations in plasmid pDL893 using the QuikChange site-directed mutagenesis kit (Stratagene).
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were detected by polyacrylamide gene electrophoresis or the Agilent DNA 1000 kit (Agilent Technologies Inc, Germany). Samples from the Innsbruck cohort and the remaining non-HPV16/18 samples from the Oslo cohort (n=40 ...
-
bioRxiv - Genetics 2020Quote: The verification of average size of the DNA fragments using the Agilent DNA 12,000 kit and the 2100 Bioanalyzer System (Agilent) equipment ...