Labshake search
Citations for Agilent :
5501 - 5550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... is a pCEP4-based plasmid that contains the humanized enhanced green fluorescent protein (hrGFP) coding sequence from phrGFP-C (Agilent) under the control of the pCEP4 CMV promoter and SV40 polyadenylation signal (39).
-
bioRxiv - Molecular Biology 2024Quote: ... and Fragment Analyzer Systems (Agilent Technologies) to assess size ...
-
bioRxiv - Molecular Biology 2024Quote: Raw MS data were analyzed using Spectrum Mill Proteomics Workbench (prerelease version B.06.01.202, Agilent Technologies). A trypsin specific enzyme search was performed using a 2017 uniprot human fasta file (UniProt.human.20171228.RISnrNF.553smORFs.264contams ...
-
bioRxiv - Microbiology 2024Quote: RNA quality and integrity was inspected in 1% agarose gels and a 2100 Bioanalyzer (Agilent). rRNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... and measured on UPLC-MS/MS (UPLC:A-30,Japan; MS/MS:ABSciex Qtrap3200, Agilent, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and checked using RNase free agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... medium was changed to Seahorse XF DMEM medium (103575-100, Agilent) supplemented with 10 mM Seahorse XF glucose solution ...
-
bioRxiv - Neuroscience 2024Quote: ... The size profiles of libraries were examined by Bioanalyzer (Agilent) and the amount was quantified by KAPA Library Quantification Kits ...
-
bioRxiv - Plant Biology 2024Quote: ... Temperature-dependent phase transition was detected by measuring the optical scattering at 800 nm while increasing the temperature from 4 to 60°C (with a ramping rate of 0.5°C/min) using a spectrophotometer Cary 300UV-VIS (Agilent Technologies). Nitrogen gas purging was used to prevent the moisture from condensing on the cuvette surface ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescence anisotropy titrations with FITC-labeled Nbs and CtRoco were performed at 25°C using a Cary Eclipse spectrofluorometer (Agilent) equipped with polarizers and temperature control ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 7.4 (Agilent,103576-100) supplemented with 1 mM sodium pyruvate (Agilent 103578-100) ...
-
bioRxiv - Physiology 2024Quote: ... purified total RNAs were analyzed on a Fragment Analyzer (Agilent) to evaluate RNA integrity ...
-
bioRxiv - Immunology 2024Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Biochemistry 2024Quote: ... by using QuikChange (Agilent) mutagenesis kit we changed its sequence to encode wild-type hSSB1.
-
bioRxiv - Immunology 2024Quote: Real-time oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were measured using a Seahorse XFe96 Extracellular Flux Analyzer (Agilent). Ex vivo isolated B cells from B-WT and B-Asns mice were stimulated (anti-CD40 at 5μg/ml and IL-4 at 10ng/ml ...
-
bioRxiv - Immunology 2024Quote: ... then followed by the MitoStress test, with oligomycin (1μM), fluorocarbonyl cyanide phenylhydrazone (FCCP, 2μM) and rotenone + antimycin A (0.5μM) (Agilent). Analyses were performed on Wave (Agilent).
-
bioRxiv - Neuroscience 2024Quote: ... Tissue sections were blocked using serum-free protein block (Dako) for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Polymer HRP-conjugated secondary antibodies (Dako) were applied for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA integrity was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies). Libraries were quantified and subjected to RNA- sequencing by Illumina PE100bp Hiseq 4000.
-
bioRxiv - Molecular Biology 2024Quote: Peptide digests (8µL each) were injected onto a 1260 Infinity nHPLC stack (Agilent Technologies), and separated using a 100-micron I.D ...
-
bioRxiv - Microbiology 2024Quote: ... QuikChangeTM site-directed mutagenesis (Agilent Technologies, Inc., Santa Clara, CA) was performed with primer pair BAP9673/9674 to introduce the mutation encoding E278A into the gene using pAL1854 (encoding Tae17C488A ...
-
bioRxiv - Immunology 2024Quote: ... Oligomycin (1.5 µM; 103672-100; Agilent), FCCP (1 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Agilent 2100 Bioanalyzer (Agilent RNA 6000 Pico Chips). Sequencing libraries were prepared using “SMARTer Stranded Total RNA-seq Kit v2 – Pico Input Mammalian” kit (Takara Bio USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Agilent 2100 Bioanalyser (Agilent RNA 6000 Nano Kit). Transcriptome libraries were constructed and sequenced by BGI and Novogene on the Illumina platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... FRET (excitation: 550 nM, emission: 668 nM) was read on a Biotek Synergy H1 microplate reader (Agilent) with Gen5 software v3.02.
-
bioRxiv - Molecular Biology 2024Quote: ... Cobalt concentrations in the mineralized biofilms were measured using ICP-MS (Agilent ICP-MS 7500, CA, USA). The certified standard reference material (BCR-414 ...
-
bioRxiv - Neuroscience 2024Quote: ... which was identified through S-parameter measurements using the network analyzer (E5071B, Agilent). After the implantation of the relay coil in the rat ...
-
bioRxiv - Pathology 2024Quote: ... and the stained cells were mounted on glass slides using Fluorescence-Mounting solution (Dako Omnis, Santa Clara, CA, USA).
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA quality was assessed on the Bioanalyzer platform using the RNA 6000 Nano assay (Agilent). mRNA was isolated from 300 ng total RNA using the NEBNext® Poly(A ...
-
bioRxiv - Neuroscience 2024Quote: ... entire sciatic nerves were mounted with Fluoromont (Dako). For cryosections ...
-
bioRxiv - Neuroscience 2024Quote: ... Quality control for constructed library was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies, 5067-4626) and Qubit DNA HS assay kit for qualitative and quantitative analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... Quality control for constructed library was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the RNA ScreenTape Analysis Kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2024Quote: ... and Agilent 4200 TapeStation (Agilent Technologies, Santa Clara, CA, USA) using the RNA ScreenTape Analysis Kit (Agilent Technologies).
-
bioRxiv - Microbiology 2024Quote: ... resistance genes were amplified by PCR from the SuperCos1 (Agilent Technologies) and pIJ690244 plasmids respectively (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... and pIJ690244 plasmids respectively (Agilent, USA) (Table S3) ...
-
bioRxiv - Microbiology 2024Quote: ... The degradation rate of crude oil was quantitatively assessed with headspace sampling analysis using Gas Chromatography with Flame Ionization Detection (GC-FID) (Agilent 7820A model). The column dimensions are 28.0 × 30.5 × 16.5 cm ...
-
bioRxiv - Microbiology 2024Quote: ... Log-phage cultures were inoculated into specified media and monitored for growth rate every 15 min at OD600 for 24 or 72 hours at 37°C under static conditions using BioTek Synergy H1 (Agilent Technologies).
-
bioRxiv - Microbiology 2024Quote: ... The plate was incubated in a BioTek Synergy H1 plate reader (Agilent Technologies) at 37°C for 48 hours ...
-
bioRxiv - Immunology 2024Quote: The tumor and normal adjacent samples were prepared using SureSelect Human All Exon V7 library (Agilent, Santa Clara USA). 100 bp paired end reads sequencing was performed using the Illumina NovaSeq 6000 system by Edinburgh Genomics (Edinburgh ...
-
bioRxiv - Immunology 2024Quote: ... The molar concentrations of the indexed libraries were measured using the 2100 Bioanalyzer (Agilent) and combined equally into pools for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... held at 45°C and that was attached to an Agilent 6546 liquid chromatography/quadrupole time-of-flight (LC/Q-TOF) mass spectrometer instrument (Agilent Technologies; Palo Alto, CA). The system was equilibrated with 100% solvent A [5 mM ammonium acetate in methanol] ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were analyzed on a DB-5 column (60 m x 0.25 mm x 0.25 μm, Agilent). Detector and injector temperature were 280 °C ...
-
bioRxiv - Microbiology 2024Quote: ... the reduction of NAD+ or oxidation of NADH was followed at 340 nm on a Cary 60 UV-Vis photospectrometer (Agilent, Santa Clara, USA) in quartz cuvettes with a path length of 1 mm (Hellma Optik ...
-
bioRxiv - Microbiology 2024Quote: Sequencing ready libraries were quality control checked by BioAnalyzer2100 instrument using High Sensitivity DNA Chip (Agilent Technologies USA, Cat. No. 5067-4626). Sequencing was carried out on NextSeq 500 sequencing system with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
Component specific responses of the microbiomes to common chemical stressors in the human food chainbioRxiv - Microbiology 2024Quote: ... DNA concentration and size of the purified library were then determined by Qubit 1.0 (Thermo Fischer) and TapeStation (Agilent, Santa Clara, CA, USA) analyses ...
-
bioRxiv - Microbiology 2024Quote: ... A ten-fold dilution series of titrated H5N1-21/22 HPAIV RNA was used to construct a standard curve using Agilent AriaMx software (Agilent, UK) to determine PCR efficiency which assured optimal assay performance for quantitative interpretation as previously described (37).
-
bioRxiv - Microbiology 2024Quote: ... An Agilent 1200 Series HPLC system was used with a refraction index detector (RID) at 50°C (Agilent, Santa Clara, CA, USA).