Labshake search
Citations for Agilent :
5451 - 5500 of 6919 citations for Nitrite Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: The FANCD2 S592A and S592D cDNAs were generated by site-directed mutagenesis of the wild type FANCD2 cDNA using the Quikchange Site-directed Mutagenesis Kit (Stratagene). The forward (FP ...
-
bioRxiv - Biochemistry 2020Quote: ... The gene coding for the H349Y GlgE variant was generated from the synthesized wild-type glgE gene using a QuikChange Lightening kit (Agilent). The constructs were ligated into pET21a expression vectors (Novagen ...
-
bioRxiv - Microbiology 2021Quote: ... and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies). The amino acid deletions in the full-length SARS-CoV-2 Spike expressor were generated using the Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA integrity was evaluated with Agilent Bioanalyzer 2100 and RNA 6000 Nano Kit (Cat-No. G2939BA & 5067-1511, Agilent, Germany). RNASeq libraries were prepared using illumina® TrueSeqTM Stranded mRNA Library Prep Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... product size distribution and quantity were assessed on a Bioanalyzer using a High Sensitivity DNA Kit (Agilent Technologies 5067-4628). A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096 ...
-
bioRxiv - Biophysics 2021Quote: The triplex-forming regions were incorporated into the parent plasmids by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: Mutations were generated in previously-described single-round plasmid derivatives of HIV-1NL4-3 (pNLdE-luc)48 and HIV-1LAI (pBru3ori-ΔEnv-luc2)49 that encoded for luciferase via the QuikChange site-directed PCR mutagenesis kit (Agilent). Resulting plasmid DNAs were verified by Sanger sequencing ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Cancer Biology 2020Quote: ... The slides were washed the next day and then incubated with biotinylated anti-rabbit secondary antibody using a DAB kit (Dako) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library and cDNA quality and profile were confirmed prior to sequencing ran on an Agilent Bioanalyzer using a Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Prepared library was then sequenced using 150 paired-end cycles on a NovaSeq S4 flow cell (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... The quality of RNA was evaluated using a Bioanalyzer 2100 with RNA 6000 Nano LabChip kit (5067-1511, Agilent Technologies). mRNA-seq libraries were prepared using TruSeq Stranded mRNA Library Prep Kit (RS-122-2101 ...
-
bioRxiv - Plant Biology 2021Quote: ... Library fragment size distribution was checked on the Agilent 2100 Tapestation System with the High Sensitivity D1000 Kit (Agilent Technologies). A total of six RNA sequencing libraries were sequenced on Nova Seq 6000 Platform (Illumina).
-
bioRxiv - Plant Biology 2020Quote: ... The integrity of the DNAse treated RNA was confirmed by capillary electrophoresis using the Agilent Bioanalyzer and the Agilent RNA 6000 Nano kit (#5067-1511, Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... Site directed mutagenesis was performed on pRK5-HA-GβL using the Quik-Change II Site Directed mutagenesis kit (200523, Agilent Technologies) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: The modified pVote0GW vector used for wild-type hTop2α overexpression was mutated by site directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent) in order to generate the plasmids harboring K418A ...
-
bioRxiv - Cell Biology 2021Quote: ... were created by point mutations on the pcDNA3.1-Cyb5r3 (WT) plasmid using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521). Mutagenesis primers were designed using Agilent’s online program ...
-
bioRxiv - Cell Biology 2021Quote: ... Point mutations and truncations were generated by site-directed mutagenesis using the QuikChange II Site-Directed mutagenesis kit (Agilent #200524) and verified by sequencing ...
-
bioRxiv - Plant Biology 2021Quote: ... The SEGS-2 ATG mutant (pNSB2110) was created in S2-1.5b (pNSB1869) using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and the primers ...
-
bioRxiv - Microbiology 2020Quote: One-step site directed mutagenesis was conducted on EhDHS1 and EhDHS2 gene by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies). Overlapping primers for site-directed mutagenesis were designed to replace phenylalanine at amino acid 302 of the pCOLD-EhDHS2 plasmid with lysine ...
-
bioRxiv - Microbiology 2020Quote: ... and the library quality and size distribution (~230 bp peak size) was checked using a 2100 Bioanalyzer with the High Sensitivity DNA kit (Agilent). Sequencing of pooled libraries ...
-
bioRxiv - Microbiology 2020Quote: ... and the library quality and size distribution (~480 bp peak size) was checked using a 2100 Bioanalyzer with the High Sensitivity DNA kit (Agilent). Sequencing of pooled libraries ...
-
bioRxiv - Microbiology 2020Quote: ... A PCR enrichment test was performed in order to determine the number of PCR cycles that are nesessery for each pool followed by a bead purification step and a QC with DNA HS kit (Agilent). Then ...
-
The circadian clock gene circuit controls protein and phosphoprotein rhythms in Arabidopsis thalianabioRxiv - Systems Biology 2021Quote: ... Phosphopeptides were enriched using the Titansphere™ spin tip kit (GL Sciences Inc.) and desalted on BondElut Omix tips (Agilent) according to the manufacturers’ instructions.
-
bioRxiv - Microbiology 2020Quote: ... ftsL30-121 and ftsW were introduced into some plasmids by using the QuickChange site-directed mutagenesis kit according to the manufacturer’s instruction (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Neuroscience 2020Quote: The single-cysteine mutations of GuD2 were generated by site-directed mutagenesis using the Quick Change II kit (Agilent technology) performed on pcDNA3-GluD220 ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA integrity and quantitation was performed using the Bioanalyzer High Sensitivity RNA 6000 Pico kit (Agilent, Cat. # 5067-1513). cDNA library preparations were conducted using the SMART-Seq v4 Ultra Low Input kit from TaKaRa (Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA quality was determined using an Agilent 2100 bioanalyzer with the high sensitivity RNA 6000 pico kit (Agilent 5067-1513). Only samples with RIN numbers higher than 5 were used for further processing.
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation and the combination of mutations found in SARS-CoV-2 variants were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana vesicular stomatitis virus (VSV ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ul was used to assess RNA Integrity Number (RIN) using the Agilent Bioanalyzer RNA nano kit (Cat # 5067-1513, Agilent). The RIN range was between 8 and 9.8 ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA-VP4-KpnI/BamHI was built by insertion of point mutations in pcDNA-VP4-SA11 using the QuikChange site-directed mutagenesis kit and protocol (Agilent) to insert KpnI and BamHI restriction sites in VP4 ...
-
bioRxiv - Microbiology 2021Quote: ... a BamHI site present in the 5’-UTR was first mutated to ggctcc using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) and primers P7/P8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase mutations were created by cloning an N-terminal POL2 PCR fragment into pRS306 and generating the mutations of interest by site directed mutagenesis using the QuickChange Lightning Kit following manufacturer’s instructions (Agilent Technologies). Polymerase mutants were introduced into MATa haploid S ...
-
bioRxiv - Molecular Biology 2021Quote: ... Correspondent seed-sequence mutated Dual-pMIR-report plasmids were obtained using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies). Low-passage COS7 cells were grown in DMEM (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and extracellular acidification rate (ECAR) were measured on Seahorse XF96 analyzer using Seahorse XF Cell Mito Stress Test Kit (Agilent). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... MinD and ClpX mutant proteins were constructed by site-directed mutagenesis of plasmids containing minD or clpX using the QuickChange II XL Site-directed mutagenesis kit (Agilent) and confirmed by sequencing prior to purification ...
-
bioRxiv - Microbiology 2019Quote: ... The mass spectrometer was calibrated in negative mode prior to data acquisition and mass accuracy during runs was ensured by a continuous infusion of reference mass solution at a flow rate of 0.06 mL/min (API-TOF Reference Mass Solution Kit, Agilent Technologies). Data quality was ensured by multiple injections of standards (with 1.5 µM concentration each ...
-
bioRxiv - Microbiology 2019Quote: All mutated MERS-CoV S constructs were generated by site directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent). pDNA3.1+/MERS-CoV S EMC/2012 served as template for all the mutagenesis performed ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutation of the active site residue Asn145 (Asn145Ala)61 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to inactivate the Spd1 DNase (see Supplementary Table S2 for primer sequences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exome regions were captured by an Agilent SureSelect Human All Exon V4 Kit and V5+ LincRNA (Agilent Technologies, CA, USA). Sequencing was performed on an Illumina HiSeq 2000 instrument (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: Site-directed insertions were made in GluN1 (GluN1-a) (NCBI Protein database accession no. P35439) or GluN2A (Q00959) subunits with the QuikChange site-directed mutagenesis kit (Agilent) with XL1-Blue super-competent cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragment size estimation of the resulting libraries was assessed with High SensitivityTM HS DNA kit runed on 2100 Bioanalyzer (Agilent) and quantified using the QubitTM dsDNA High Sensitivity HS assay (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Cell Biology 2020Quote: ... The OCR was then measured with an XF24 Extracellular Flux Analyzer via the XF Cell Mito Stress Kit (Agilent Seahorse). Following 5 measurements of basal OCR ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Biochemistry 2022Quote: ... according to the construct used by the Xia lab [48] was generated by the restriction free cloning method [54] and site-directed mutagenesis (QuickChange Site-Directed Mutagenesis Kit, Agilent). Expression and purification were carried out as described in Tang and Xia [48].
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The rRNA-depleted RNAs were converted to paired end libraries using Sure Select Strand Specific RNA Kit (Agilent Technologies, USA) or TruSeq RNA Library Prep Kit v2 (Illumina ...