Labshake search
Citations for Agilent :
5451 - 5500 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and the quality was checked on Agilent Bioanalyzer 2100 using RNA 6000 Nano Kit (#5067-1511, Agilent).
-
bioRxiv - Immunology 2021Quote: ... and cDNA size distribution was measured using the High-Sensitivity DNA Bioanalyzer Kit (Agilent, Cat# 5067-4626).
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated in basal media prior to injections using the XF Glyco Stress kit (Seahorse Bioscience). For evaluation of the acute response to mDivi-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... WSB2 (SOCSΔ364-400) and Rbx1 (C53A/C56A) were generated using site directed mutagenesis kit (Agilent, California, USA). All constructs were confirmed by sequencing.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit, Agilent). All samples with a RNA integrity number (RIN ...
-
bioRxiv - Cell Biology 2022Quote: ... Radioactive probes were synthesized from gel-purified templates using a Prime-it RmT Random Labeling Kit (Agilent) and alpha-32P-dCTP (Perkin Elmer) ...
-
bioRxiv - Systems Biology 2022Quote: ... The RNA integrity was then verified with the RNA 6000 Nano Kit using a Bioanalyzer 2100 (Agilent). DNA was quantified with the Qubit dsDNA BR assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from near-confluent 6 cm dishes using the Absolutely RNA Miniprep kit (Agilent) including an on-column DNase treatment step according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PBP2 D515N and C551S mutants were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). Cloned vector was then transformed into BL21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). To make the constructs for expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Microbiology 2022Quote: ... Altered rsmY and rsmZ reporters were constructed using the QuikChange II XL site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... a glucose-dependency test was performed using the Seahorse XF Glycolysis Stress Test Kit (Agilent, 103020-100). Prior to extracellular flux measurements ...
-
bioRxiv - Biophysics 2022Quote: ... Point mutations were made in the KCNQ2 gene using the Quikchange XL site-directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... using Seahorse XF Cell Mito Stress and Glyco Stress Test Kit and XFe96 Extracellular Flux Analyzer (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Analysis was performed using the XF assay with the cell mito stress test kit (Agilent Seahorse Biosciences). Three measurements were assessed under basal conditions and after the addition of 2 µM oligomycin ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Analysis was performed using the XF assay with the cell mito stress test kit (Agilent Seahorse Biosciences). Three measurements were assessed under basal conditions and after the addition of 2 µM oligomycin ...
-
bioRxiv - Molecular Biology 2020Quote: Basal oxygen consumption was measured using the Seahorse XF Cell Mito Stress Test Kit (Agilent, #103015-100) on a Seahorse XF96 Analyzer (Agilent ...
-
bioRxiv - Genetics 2021Quote: ... and QC by High Sensitivity DNA kit analysed using the 2100 Bioanalyzer High Sensitivity DNA assay (Agilent). Sequencing was performed using the HiSeq4000 Sequencing System (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from the leaf tissue using the Plant RNA Isolation Mini Kit Protocol (Agilent Technologies). RNA quality and concentration was measured using a NanoDropTM Lite Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). All samples were pooled to equimolar concentration and sequenced together across twenty-eight lanes on an Illumina Hi-Seq 4000.
-
bioRxiv - Neuroscience 2021Quote: ... followed by incubation with freshly prepared AB mix of Vector Elite ABC Kits and with DAB (DAKO Agilent Pathology Solutions ...
-
bioRxiv - Neuroscience 2020Quote: ... C289A) were generated by site directed mutagenesis of pRmHA3-CaMKII using QuickChange Lighting Kit (Agilent, Catalog 210518.) The full coding sequence of all pRmHA3-CaMKII constructs was verified by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using AffinityScript cDNA synthesis kit according to manufacturer’s instructions (Agilent Technologies, CA, USA). Commercially available gene-specific TaqMan probes for Ager (Mm 01134790_g1) ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was assessed using the Agilent 2100 Bioanalyzer and RNA Nano Chip kit (Agilent Technologies, CA). RNA-seq libraries were generated using TruSeq Stranded Total RNA with Ribo-Zero Globin Complete kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... libraries were prepared using the Illumina TruSeq stranded mRNA kit and validated on the Bioanalyzer 2100 (Agilent). Samples were sequenced using the Illumina HiSeq 2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Genomics 2022Quote: ... and an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies Ltd., Cork, Ireland), according to the manufacturers’ instructions ...
-
bioRxiv - Pathology 2022Quote: ... The libraries were quantified using the Agilent 2100 Bioanalyzer System with a High Sensitivity DNA Kit (Agilent) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality of the generated libraries was monitored by using the High Sensitivity DNA Analysis Kit (Agilent) and the Bioanalyzer 2100 ...
-
bioRxiv - Genomics 2022Quote: Lung total RNA quality and quantity were examined using a Bioanalyzer (Agilent 2100, RNA 6000 nano kit). Sequencing libraries were constructed using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The quality of RNA isolated was checked using Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA). For RNA seq ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets were lysed and RNA was isolated using the Absolutely RNA Microprep Kit (400805, Agilent Technologies), Absolutely RNA Nanoprep Kit (400753 ...
-
bioRxiv - Immunology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
bioRxiv - Immunology 2022Quote: ... and Bioanalyser-2100 equipped with an RNA 6000 Nano Kit (5067-1511; Agilent Technologies, Santa Clara, CA). cDNA was synthesized using iScript Kit (1708891 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the quality of the RNA samples checked on an Agilent Bioanalyzer (Agilent; RNA 6,000 Nano kit).
-
bioRxiv - Neuroscience 2022Quote: RNA integrity was analyzed on an Agilent 2100 Bioanalyzer using RNA 6000 Nano kit (Agilent, 5067-1511). Only samples with an RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2022Quote: ... constructs were generated by site-directed mutagenesis based on enNTS1ΔM4 (M2044.60/M2084.64/M2445.45/M2505.51/M3306.57/M3527.36) using the Lightning site-directed mutagenesis kit (Agilent, Santa Clara, CA) and the forward and reverse primers CACTACTTCTACCTGCTGTCTAACGCGCTGG and CCAGCGCGTTAGACAGCAGGTAGAAGTAGTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library QC was assessed using an Agilent Technologies Bioanalyzer High Sensitivity kit (Agilent Technologies, Cat#5067-4626).
-
bioRxiv - Molecular Biology 2019Quote: CbAgo double mutant (D541A, D611A) was generated using an adapted Quick Directed Mutagenesis Kit instruction manual (Stratagene). The primers were designed using the web-based program primerX (http://bioinformatics.org/primerx).
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and RNA quality was assessed using an Agilent 2100 Bioanalyzer and an RNA 6000 Nano kit (Agilent) to confirm integrity ...
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).