Labshake search
Citations for Agilent :
501 - 550 of 1342 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed three times for 20 min in TBS-T before incubation with horseradish peroxidase (HRP)-labeled secondary antibody in TBS-T at RT for 1 hour: Goat anti-Rabbit HRP (1:10,000, Agilent P0448), Rabbit anti-Goat HRP (1:10,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... For staining of macrophages and platelets the aortic tissue sections were blocked for 1 h at RT with protein blocking solution (#X0909, Dako). After blocking ...
-
bioRxiv - Genetics 2021Quote: ... and subcloned using Strataclone PCR Cloning Kit (Agilent 240205). Either Donorguide or ssODN injected zebrafish were combined ...
-
bioRxiv - Developmental Biology 2020Quote: ... and PCR was performed using Herculase II Polymerase (Agilent).
-
bioRxiv - Plant Biology 2020Quote: ... using the Mx3000P Real Time PCR System (Agilent Technologies) cycler ...
-
bioRxiv - Systems Biology 2019Quote: ... and polished with a PCR polishing kit (Agilent, # 200409) to generate blunt-end DNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Pooled PCR products were purified with AMPure beads (Agilent), and 5ng of the purified pools was barcoded with Fluidigm Access Array barcodes using AccuPrime II (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... PCR was immediately performed using PfuTurbo Cx (Agilent #600410) (94°C 2 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... on an AriaMX Real Time PCR System (Agilent Technologies). Next generation sequencing was performed by paired-end sequencing of the V4 region using MiSeq Reagent Kit version 3 ...
-
bioRxiv - Bioengineering 2021Quote: ... on an AriaMx Real-Time PCR System (Agilent Technologies). Collagen and BMP-2 mRNA expression data was calculated with the 2-ΔΔCT method using human GAPDH as a reference ...
-
bioRxiv - Cancer Biology 2019Quote: ... and an AriaMX Real Time PCR system (Agilent Technologies). miScript primer assays (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v3.2 (Agilent).
-
bioRxiv - Physiology 2021Quote: ... The MxPro-3000 PCR machine (Stratagene, La Jolla, CA) was used for quantification ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was run on Aria Mx3000 thermocycler (Agilent) with 40 cycles at 60°C annealing temperature for 10 seconds and 72°C elongation for 15 seconds and subsequent melting curve (65°C – 95°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the library was PCR amplified using Herculase II (Agilent) in the 96-well plate to increase the coverage for 22 cycles with the following program (98°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed in triplicate (Agilent AriaMX G8830A) on 4 ng of cDNA in a 10 µL reaction consisting of SYBR green master mix (Applied Biosystems #4367659 ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were visualized on a TapeStation (Agilent). PCR products were electrophoresed on a 2% agarose gel ...
-
bioRxiv - Microbiology 2022Quote: ... running on AriaMx Real-Time PCR system (Agilent Technologies) using a standard thermal cycle program with 25 s at 62 °C for annealing and 30 cycles ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was performed in an AriaMx thermal cycler (Agilent) using EvaGreen to monitor double-stranded DNA synthesis ...
-
bioRxiv - Cell Biology 2022Quote: ... in a AriaMx Real-Time PCR System (Agilent, G8830A). Relative fold gene expression was calculated with the 2–ΔΔCt method.
-
bioRxiv - Evolutionary Biology 2019Quote: We used quantitative PCR (qPCR) (MX3000P, Agilent Technologies, Germany) to confirm that tetracycline-treated flies were cleared of wMau ...
-
bioRxiv - Cell Biology 2019Quote: ... in a Stratagene Mx3000P real-time PCR system (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... qRT-PCR analyses were displayed with SYBR Green (Agilent) by an CFX96 Real-Time PCR machine ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and subcloned using StrataClone PCR cloning Kit (Agilent Technologies) and sequenced.
-
bioRxiv - Immunology 2020Quote: ... and amplified by PCR using PfuTurbo DNA Polymerase (Agilent) with published primers (Wang et al. ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was conducted with a Stratagene Mx3005P (Agilent technologies) using the following thermal profile ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on a AriaMx Real-time PCR system (Agilent Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and heated in an Mx3005P Q-PCR system (Stratagene) from 25 to 95°C with a step interval of 1°C ...
-
bioRxiv - Cell Biology 2021Quote: ... on an Aria Mx Q-PCR system (Agilent Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... using the Mx3000P Real Time PCR System (Agilent Technologies) cycler ...
-
bioRxiv - Biochemistry 2023Quote: ... 66.3°C) in a PCR machine (Agilent SureCycler 8800) followed by 3 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... using SYBR Green PCR Master Mix II (Agilent Technologies). Amplicons representing target genes and the endogenous housekeeping gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were quantified on 2100 Analyzer instrument (Agilent), heat-denatured and circularized by a splint oligo sequence to generate circular DNA nanoball (DNB ...
-
bioRxiv - Cancer Biology 2023Quote: ... on the AriaMx Real-Time PCR System (Agilent Technologies) using the primers listed in Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using AriaMX (Agilent Technologies, USA) with a SYBR Green PCR Master Mix (Primer sequences are provided in Supp Table I) ...
-
bioRxiv - Microbiology 2023Quote: ... and the AriaMx Real-Time PCR system (Agilent Technologies) following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed in triplicate (Agilent AriaMX G8830A) on 4 ng of cDNA samples (along with a no-template and a no-RT control ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The StrataClone PCR cloning kits were purchased from Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR reactions with the high-fidelity Phusion polymerase (Agilent) amplified the synthetic gBlock and two overlapping fragments derived from approximate halves of the pKK223 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... before setting to a real-time PCR system (Agilent) with the following parameters ...
-
bioRxiv - Microbiology 2023Quote: ... PCR were done using high-fidelity DNA Polymerase (Agilent). Marked non-polar deletion mutants were constructed using a splicing PCR (sPCR ...
-
bioRxiv - Microbiology 2024Quote: ... using the StrataClone Blunt PCR cloning kit (Agilent Technologies). After Sanger sequencing verification of selected clones ...
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by double-stranded plasmid mutagenesis using the primer pairs listed in Table S1 and a Quikchange Site-Directed Mutagenesis Kit (Agilent Tech.). After verification by DNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... and amplified with the primers to yield an amplicon roughly 150-250 base pairs in length using Herculase II Fusion Polymerase (Agilent #600675). The PCR protocol involved a 2 minute denaturation at 95C ...
-
bioRxiv - Microbiology 2019Quote: Libraries were checked for small fragments (primer dimers and/or adapter dimers) using a 2100 Bionanalyzer (Agilent, Santa Clara, CA, USA) with the High Sensitivity DNA kit (Agilent) ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Genomics 2021Quote: ... Gene-specific probes were generated by random priming in the presence of ATP [α32P] using the Prime-It II Random Primer Labeling Kit (Agilent, 300385) using PCR generated DNA template produced from gDNA isolated from a wild type S.pombe strain (YP71 ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA was next converted to cDNA by using a polydT primer and following the AffinityScript Multiple Temperature cDNA Synthesis kit instructions (Agilent Technologies). In order to quantify the HEV genome ...
-
bioRxiv - Biophysics 2021Quote: ... and E217A were cloned with primers IF733 and IF734 using QuikChange Lightning Multi Site-Directed Mutagenesis Kit to generate plasmid pIF585 (Agilent #210516). RAD51(K133R ...