Labshake search
Citations for Agilent :
501 - 550 of 1199 citations for Recombinant Enhanced Green Fluorescent Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master mix (Agilent) in real time PCR (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and was analyzed by qPCR using the Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... we used Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... followed by qPCR using Brilliant III Ultra-Fast SYBR® Green qPCR Master Mix (Agilent), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... MCM7 forward: CCCCTCTTTCTCCCATGCTG reverse: AGGCCCAGGCTAGAAGATGA) and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828).
-
bioRxiv - Molecular Biology 2021Quote: ... Each 20 μL reaction was prepared using the Brilliant II SYBR Green QPCR system (Agilent) following the manufacturer’s guidelines with the primers listed in Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative qRT-PCR was performed with the Brilliant II SYBR Green QPCR Master Mix (Agilent). Primers were designed to amplify ∼150 bp product within the target genes ...
-
bioRxiv - Microbiology 2023Quote: ... and qPCR was performed using the Brilliant II SYBR® Green QPCR master mix (Agilent). PCR primer sequences included XIAP (F ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence polarization filter cube (Green FP, EX 485/20 nm;EM 528/20 nm, Agilent) was used to measure polarization with the plate reader (Synergy Neo2 ...
-
bioRxiv - Neuroscience 2023Quote: qRT-PCR reactions were performed using Brilliant II SYBR Green qPCR Master Mix (Agilent #600828) according to manufacturer instructions using a Light Cycler HT7900 (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green qPCR Master Mix (Agilent) in an ABI 7500 real-time qPCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR was performed using cDNA (50ng) and a Brilliant II sybr green mastermix (Agilent). Both the PCR array and qPCR were run on an Agilent AriaMx PCR machine ...
-
bioRxiv - Immunology 2024Quote: ... The insertion of DNA encoding His-tag was performed using appropriate primers (Table 1) and a PfuUltra high-fidelity DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) PCR reaction.
-
bioRxiv - Genetics 2024Quote: Recombinant adenoviruses expressing mouse SAR1A or SAR1B were constructed using pAdTrack-CMV and the AdEasy adenoviral vector system (Agilent Technologies, Lexington MA). Adenoviruses were amplified in Ad293 cells and purified using CsCl gradient ultracentrifugation ...
-
bioRxiv - Cell Biology 2021Quote: ... The aorta was opened in a reproducible manner by cutting along the greater curvature then mounted on glass slides with mounting medium (Dako Fluorescent; DakoCytomation).
-
bioRxiv - Neuroscience 2023Quote: ... sections were counterstained with DAPI (1:1000 in 1X PBS) for 5 min and coverslipped with fluorescent mounting medium (#S3023, DAKO, Jena, Germany). Images were obtained using an Axioplan M2 fluorescent microscope (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the sections were mounted into microscopic slides (Epredia™ SuperFrost Plus™ Adhesion Microscopic Slides) and covered with coverslips (Eprdia Cover Slip) along with fluorescent mounting medium (DAKO). The imaging was done by inverted laser scanning confocal microscope (LSM 880 ...
-
bioRxiv - Cell Biology 2023Quote: For confocal laser scanning microscopy all images were taken from fixed specimens embedded in Dako fluorescent mounting medium (Dako Inc, Carpinteria, USA) on a LEICA SP5 confocal microscope equipped with a 63.0x/1.40 NA oil HCX PL APO CS UV objective and analyzed using LAS AF Lite software ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue sections were washed thrice in PBS, mounted on adhesive-coated, positively charged slides (InstrumeC, AUS) with fluorescent mounting medium (Agilent Technologies, USA) and sealed with nail polish ...
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Plant Biology 2021Quote: ... and HotStart-IT SYBR Green qPCR Master Mix (Cat# 600882, Agilent Technologies, Santa Clara, CA, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with Brilliant II Ultra-Fast SYBR® Green QPCR Master Mix (Agilent) using a Bio-Rad CFX96 Real-Time Detection System ...
-
bioRxiv - Plant Biology 2019Quote: ... All reactions were made with the Brilliant SYBR Green Master Mix (Stratagene Inc., Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 20 ng cDNA and the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies). Relative mRNA expression was obtained using the ΔΔCt method using β-actin as reference gene 68.
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR using Brilliant II SYBR® Green QPCR Master Mix (Agilent, Santa Clara, CA, USA) was outperformed on CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA was measured by qPCR using Brilliant III Ultra-Fast SYBR Green qPCR mix (Agilent) in the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... susceptible and tolerant pigs using an SYBR green in AriaMx Real-Time PCR system (Agilent, US). The qPCR was performed in a 10μL reaction volume containing 1μL cDNA (50ng ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was employed to measure mtDNA using Applied Biosystems SYBR Green Master Mixes (Agilent Technologies) in a QuantStudio TM 6 Flex Fast Real-Time PCR System ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed using the Brilliant III ultra-Fast SYBR green qPCR master mix (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Biochemistry 2023Quote: ... SYBR Green Real-time PCR experiments were performed using AriaMx Real-Time PCR (Agilent, California, America) and Taq Pro Universal SYBR qPCR Master Mix (Vazyme) ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant transfer vector was linearized by PmeI and transformed into electro-competent E.coli strain BJ5183-AD-1 (Stratagene, Cat. No. 200157-11) for in vivo recombination with pAdEasy vector ...
-
bioRxiv - Microbiology 2023Quote: ... Sequence encoding the 96-120 NS2B residues was removed from recombinant pTrcHisA plasmid by PCR based site directed mutagenesis [40] using Pfu ultra II fusion HS DNA polymerase (Agilent, Santa Clara, USA) to generate recombinant plasmids expressing N-terminal hexahistidine tag fused active NS2B(H)-NS3(pro ...
-
bioRxiv - Genomics 2021Quote: ... 100 nucleotides) was verified by fluorescent capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 pico kit, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... was used to create fluorescent complementary RNA (cRNA) followed by hybridization to microarrays using Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, USA). Fluorescence signals were detected using SureScan Microarray Scanner (Agilent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... eye cups were post-fixed for 10 min in 4 % FA-PBS at RT following by flat-mounting with fluorescent mounting medium (Dako, Carpinteria, CA, USA). Fluorescence images were acquired with Nikon Eclipse Ti-E microscope (Nikon ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an additional serum-free protein block (DakoCytomation) to reduce nonspecific binding of endogenous proteins ...
-
bioRxiv - Synthetic Biology 2019Quote: ... After blocking with serum-free protein block (Dako), they were incubated with the primary antibodies for 120 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial acidic fibrillary protein (GFAP)(Dako), mouse anti-glutamic acid decarboxylase 67 (GAD67 ...
-
bioRxiv - Bioengineering 2020Quote: Proteins were expressed in BL21(DE3)Gold (Stratagene) and purified as described previously6 ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were expressed using BL21(DE3) cells (Agilent). The cells were grown at 37°C until an optical density at 600nm of .6 then induced with 0.2mM isopropyl-Beta-D-thiogalactoside overnight at 18° C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein blocking was performed for 20 min (Dako). NUP210 primary antibody (Atlas ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was overexpressed in BL21(DE3) RIL (Agilent) at 37 °C in Terrific Broth (TB ...
-
bioRxiv - Pathology 2021Quote: ... Slides were placed in a Protein Block (DAKO) for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...