Labshake search
Citations for Agilent :
501 - 550 of 5617 citations for Rat IL 3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Systems Biology 2020Quote: ... Enriched mRNA was purified using Agencourt RNAClean XP Kit and analyzed with Bioanalyser RNA 6000 Pico Kit (Agilent). In continuation ...
-
bioRxiv - Molecular Biology 2019Quote: ... in MDA-MB-231 cells were assessed by Agilent Seahorse XF Cell Mito Stress Test Kit and Agilent Seahorse XF Cell Energy Phenotype Test Kit (Agilent Technologies) and run in Agilent Seahorse XFe96 Analyzer (Seahorse Bioscience ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was extracted and purified from individual tissues according to kit instructions (Agilent Absolutely RNA Nanoprep Kit, 400753), eluted in 13 µL RNA elution buffer ...
-
bioRxiv - Zoology 2021Quote: ... with Agilent DNA 1000 Kit (Agilent Technologies). Subsequently ...
-
bioRxiv - Cell Biology 2019Quote: ... The Seahorse MitoStress kit (103015-100, Agilent) was used to prepare dilutions of the mitochondrial inhibitors which had the following final concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to introduce mutations into Env in plasmid pRS1 as described before ...
-
bioRxiv - Molecular Biology 2021Quote: ... using RNA 6000 pico kit (Agilent Technologies). Directional polyA RNA-Seq libraries were constructed using the TruSeq Stranded mRNA library prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... D1000 ScreenTape kit (Agilent Technologies; 5067-5582), Qubit(r ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the RNA 6000 Nano kit (Agilent). Minute run-to-run shifts in band sizes are due to inherent limitations of the instrument.
-
bioRxiv - Immunology 2021Quote: ... with the RNA 6000 Pico kit (Agilent) in order to calculate RNA integrity ...
-
bioRxiv - Immunology 2019Quote: ... Bioanalyzer fragment analysis (HS DNA Kit, Agilent) and KAPA library quantification qPCR (Roche) ...
-
bioRxiv - Genomics 2019Quote: ... with an RNA 6,000 Nano Kit (Agilent). RNA sequencing libraries were made using the TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina ...
-
bioRxiv - Physiology 2019Quote: ... with the Mito Stress Test Kit (Agilent). Chemicals (1μM oligomycin ...
-
bioRxiv - Systems Biology 2019Quote: ... and Bioanalyzer RNA 6000 Nano Kit (Agilent), respectively.
-
bioRxiv - Microbiology 2019Quote: ... with the High Sensitivity DNA kit (Agilent). The concentration of libraries was quantified using Picogreen dsDNA assay as above ...
-
bioRxiv - Microbiology 2019Quote: ... using the Agilent DNA 1000 Kit (Agilent). The libraries were multiplexed and submitted to NGS on a NextSeq500 sequencer (Illumina ...
-
bioRxiv - Neuroscience 2019Quote: ... The EnvisionTM+ kit (DAKO, Santa Clara, USA) was used as a high-sensitivity visualization system ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and Bioanalyzer (High Sensitivity DNA Kit, Agilent). Libraries were diluted to 2 nM in 10 μL 10 mM Tris-HCl (pH 8.5 ...
-
bioRxiv - Microbiology 2021Quote: ... and the High Sensitivity DNA kit (Agilent). The quantity of the libraries was measured by real-time PCR using the LightCycler® 480 Instrument II (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... a QuikChange site-directed mutagenesis kit (Stratagene) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... Illumina library quality was assessed by Agilent DNA 1000 Bioanalyzer kit (5067-1504, Agilent), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... using the Quick-Change mutagenesis kit (Stratagene) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and DAB substrate kit (DAKO, Burlington, ON). Sections were counterstained with Hematoxylin ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MycoSensor qPCR Assay Kits (Agilent Technologies) were used to detect mycoplasma contamination ...
-
bioRxiv - Biochemistry 2021Quote: ... with QuikChange site-directed mutagenesis kit (Agilent). siPaip2 (5’-GAGUACAUGUGGAUGGAAAUU-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... Site directed mutagenesis (Agilent’s QuickChange II kit) was performed using mutagenesis primers detailed in Supplemental Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... with the RNA 6000 Nano Kit (Agilent). Samples were quantified using the Qubit 2.0 fluorometer and the Qubit RNA Broad Range assay.10 ng of RNA was reverse-transcribed to cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The anti-rabbit EnVision kit (Agilent, CA) was used for signal amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... and the RNA 6000 pico kit (Agilent). Only samples with RIN > 8.5 were processed.
-
bioRxiv - Biochemistry 2022Quote: ... The Bioanalyzer RNA 6000 Pico Kit (Agilent) was used to evaluate the purity of the mRNA prior to LC-MS/MS analysis.
-
bioRxiv - Immunology 2022Quote: ... using the High Sensitivity DNA Kit (Agilent). Percent of exon 6 exclusion was determined as ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Agilent High Sensitivity DNA kit (Agilent). Libraries were pooled together and sequenced on Illumina miSeq or NEXTseq platforms according to the manufacturer’s specifications.
-
bioRxiv - Microbiology 2022Quote: ... with the Genomic DNA 50kb kit (Agilent). Libraries were then prepared from 400 ng of genomic DNA following the Rapid Barcoding Sequencing kit (SQK-RBK004 ...