Labshake search
Citations for Agilent :
501 - 550 of 1488 citations for Mouse FAM20B shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal CD31 anti-human clone JC70A (M0823, Agilent Dako, Santa Clara ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit anti-mouse (Agilent, P0260022-2, 1:3000).
-
bioRxiv - Cancer Biology 2022Quote: ... biotinylated anti-mouse/rabbit secondary antibodies and Streptavidin-HRP (Dako), followed by TSA visualization with fluorophores Opal 520 ...
-
bioRxiv - Pathology 2023Quote: ... the monoclonal mouse antibody (M7237, Clone D5/16 B4, Dako) was incubated for 30 minutes at room temperature at a 1∶200 dilution followed by Labelled Polymer-HRP Anti-Mouse for 30 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... and peroxidase-conjugated anti-mouse antibody (Dako, Cat. No. P0260).
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT.
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT.
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-human CD68 (Dako #M0814, 1:400 dilution), following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT ...
-
bioRxiv - Biophysics 2022Quote: ... and a goat anti-mouse HRP conjugated (P0447, Dako, Denmark).
-
bioRxiv - Genetics 2023Quote: ... and anti-mouse HRP-conjugated (1:1000) secondary antibody (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... Both mouse monoclonal anti-Ki67 CloneMIB-1 (Dako, cat# M7240) and rabbit polyclonal antibody MGP (ProteinTech ...
-
bioRxiv - Pathology 2023Quote: ... CD20 (mouse monoclonal, clone L26, Dako; or goat polyclonal, Thermofisher), CD117 (rabbit polyclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... EnVision System-HRP Labelled Polymer Anti-Mouse (DAKO, Cat# K4001) was applied for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse monoclonal anti-CKAE1/AE3 (Dako, M3515, 1:200 dilution) were added to their respective spheroids and incubated for 2 days at 4 degrees ...
-
bioRxiv - Immunology 2023Quote: ... and applied to Whole Mouse Genome Array Ver2.0 slides (Agilent). After hybridization at 65 °C for 17 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... thyroid transcription factor (TTF-1) (mouse, M3575, 1:100; Dako), and p40 (rabbit ...
-
bioRxiv - Cancer Biology 2023Quote: ... or rabbit anti-mouse IgG HRP (Agilent technologies, P044701-2) at 1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... SMA (mouse anti-SMA, 1:100, Dako, Cat. no. M0851) was assessed after 10 days as described above ...
-
bioRxiv - Microbiology 2024Quote: ... or rabbit anti-mouse HRP (Dako P0161 1:3000 dilution). Labelled membranes were developed with Immobilon HRP substrate (Millipore Sigma WBKLS0500 ...
-
bioRxiv - Plant Biology 2024Quote: ... and secondary antibodies α-mouse-HRP (Agilent, P0260, 1:5000), α-rat-HRP (GE HealthCare ...
-
bioRxiv - Pathology 2024Quote: ... and podoplanin (mouse monoclonal antibody, clone D2-40; Dako/Agilent). Detailed information on these primary antibodies is presented in Table S2 ...
-
bioRxiv - Pathology 2024Quote: ... and podoplanin (mouse monoclonal antibody, clone D2-40; Dako/Agilent). Detailed information on these primary antibodies is presented in Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µg of plasmid ASAP3 and ASAP3-R3 were added into the solution of GeneJammer (Agilent) transfection reagent in Opti-MEM (3 µL in 200 µL) ...
-
bioRxiv - Immunology 2021Quote: Spike-expressing plasmid constructs were generated using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent) on a previously described Wuhan-hu-1 template34 ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced into the pMicC plasmid using a QuikChange Lightning site-directed mutagenesis kit (Stratagene). Oligonucleotides used in this study are listed in Table S2.
-
bioRxiv - Plant Biology 2021Quote: ... Plasmids used for rice transformation were created by site-directed mutagenesis (Quikchange lightning technology, Agilent technologies) to introduce point mutations in the genomic sequence of RGA5 already cloned in pAHC17 ...
-
bioRxiv - Immunology 2021Quote: ... ORF9 mutant plasmids were generated using site directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit, Agilent). GST-fusion bacterial expression vectors for FLAG-ORF9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Longer inserts flanked by longer homology arms were cloned into pBluescript II KS-plasmid (Agilent Technologies). All TALEN and Cas9 target sequences and donor sequences for homologous recombination are listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV vectors were generated by triple transfection of 293T/17 cell line using Polyethylenimine (PEI) and plasmids pAAV-hsynapsin-HA-ΔN-DGKκ or pENN.AAV.hSynapsin.EGFP.RBG together with pHelper (Agilent) and pAAV2/9 or pAAV2/Rh10 (provided by J.Wilson and J.Johnston at Penn Vector Core) ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: All AAV6 vectors were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), which contains inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 40 ng/μl of a transfection reporter plasmid encoding humanized Renilla GFP (hrGFPII; Stratagene) and 0.01% Fast Green (AppliChem).
-
bioRxiv - Biochemistry 2023Quote: ... the plasmid was transformed into BL21-Gold (DE3) competent cells (Agilent Technologies, Santa Clara, CA, USA) and inoculated onto LB agar plate supplemented with 50 ug/ml kanamycin.
-
bioRxiv - Biophysics 2023Quote: ... The WT and high-specificity Rec3 plasmids were transformed into BL21-Gold (DE3) competent cells (Agilent) and expressed in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... Mutagenesis of the different plasmids was achieved using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). All plasmids were freshly transformed into the appropriate strains before each of the experiments.
-
bioRxiv - Bioengineering 2023Quote: ... In silico assembly and de novo synthesis of transformation plasmids using pBluesript II KS (+) (Stratagene, USA) as the backbone vector was done in the Snapgene (software v ...
-
bioRxiv - Biochemistry 2023Quote: ... SUV420H1 plasmid was transformed into Escherichia coli BL2-codon plus (DE3)-RIL competent cells (Agilent technologies) and grown in 2xYT-Kan media ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... Mutagenesis of the plasmids was performed with the indicated primers (Table S4) using PfuTurbo Polymerase (Agilent) followed by DpnI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... H3.3 mutations were introduced into the pBabePuro dH3.3-IRES GFP plasmid using site-directed mutagenesis (Agilent). Plasmids were verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... Mutations in the wild type heavy chain plasmid were performed using site directed mutagenesis (Agilent, 200524) following the manufacturer’s protocol to generate EG ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by secondary antibody Envision+ anti-mouse labeled-polymer (Dako/Agilent). Slides were counterstained using Gill’s I hematoxylin (Richard-Allen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by secondary antibody Envision+ anti-mouse labeled-polymer (Dako/Agilent). Slides were counterstained using Gill’s I hematoxylin (Richard-Allen) ...