Labshake search
Citations for Agilent :
501 - 550 of 6319 citations for Human NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples are hybridized on the microarray slide (4×44K Human Genome CGH Microarray, Agilent Technologies). The slides were scanned using an Agilent dual laser DNA microarray scanner G2566AA ...
-
bioRxiv - Cell Biology 2020Quote: ... and prediluted polyclonal Guinea Pig anti-human Insulin (cat. IR002 - Agilent Technologies, Santa Clara, CA, USA) as second and third primary antibodies for 1h at room temperature (RT) ...
-
bioRxiv - Neuroscience 2020Quote: ... These data were obtained with Agilent SurePrint G3 Human GE v2 8×60K microarray (Agilent Technologies) from peripheral blood samples (all samples had RNA integrity number (RIN ...
-
bioRxiv - Genomics 2020Quote: ... LECs were washed twice in DPBS and stained with mouse anti-human Ki-67 antibody (Dako) diluted 1:800 in FACS buffer (DPBS with 1mM EDTA and 2% FBS ...
-
bioRxiv - Systems Biology 2019Quote: ... plasma samples were assayed using quantitative western blotting using a polyclonal antibody to human RBP4 (Dako) and human TTR (Dako ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tissue sections were incubated with primary antibodies to anti-human Ki-67 (Clone MIB-1, DAKO) and cleaved caspase-3 (Cell Signaling ...
-
bioRxiv - Genetics 2021Quote: ... with Agilent SureSelect XT Target Enrichment System and Human All Exon V5 capture baits (Agilent Technologies), following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... with Agilent SureSelect XT Target Enrichment System and Human All Exon V5 capture baits (Agilent Technologies). Next generation sequencing was carried out using the Illumina NextSeq500 or HiSeq 2500 platform with 2×79-144 cycles by the OHSU Massively Parallel Sequencing Shared Resource to an average depth of 100X per library replicate ...
-
bioRxiv - Cancer Biology 2022Quote: We performed immunochemistry assays using mouse anti-human ki67 antibody (M7240, DAKO, 1/200 at pH9) in a series of paraffin-embedded tissue blocks of HGSOC ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Cell Biology 2022Quote: ... A1AT was immuno-detected using the primary rabbit polyclonal anti-human A1AT ab (A0012, Dako, Agilent) at a 1:1,000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... A1AT was immuno-detected using the primary rabbit polyclonal anti-human A1AT ab (A0012, Dako, Agilent) at a 1:1,000 dilution ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-human IgG4 (Nordic clone N315, Nordic MUbio) and rabbit anti-mouse-AP (D0314, Dako) were used as secondary antibodies and conjugate respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... the analysis was performed using one color SurePrint G3 Human GE 8×60k Microarrays (Agilent Technologies), and the data is available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress ...
-
bioRxiv - Molecular Biology 2022Quote: Human K560-GFP and squid K554-GFP constructs were purified from BL21-CodonPlus(DE3)-RIPL (Agilent) E ...
-
bioRxiv - Genetics 2022Quote: ... the library was constructed using SureSelect All Human Exon V7 (Agilent Technologies, Cedar Creek, TX, USA). The library was paired-end sequenced (2×100 bp ...
-
bioRxiv - Neuroscience 2023Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 megabase pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq 4,000 (sx75 base-pair paired-end configuration ...
-
bioRxiv - Microbiology 2023Quote: ... β-catenin was detected using an anti-human β-catenin antibody (1:1000) (Agilent Dako, USA). After three washes in 1X PBS – 0.3% Tween 20 ...
-
bioRxiv - Microbiology 2023Quote: ... β-catenin was detected using an anti-human β-catenin antibody (1:1000) (Agilent Dako, USA). After three washes in 1X PBS – 0.3% Tween 20 ...
-
bioRxiv - Cell Biology 2023Quote: ... we performed immunochemistry assays using mouse anti- human ki67 antibody (M7240, DAKO, 1/200 at pH9) in a series of paraffin-embedded tissue blocks of HGSOC ...
-
bioRxiv - Cell Biology 2022Quote: ... the data of GSE9210 were based on the GPL887 Platforms (Agilent-012097 Human 1A Microarray (V2) G4110B ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... The Telomere PNA Kit/FITC kit from Dako (Agilent) was used to estimate Telomere length signal in samples ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Plant Biology 2019Quote: ... GC-separation was achieved on a HP-5 column (Agilent Technologies) using the following temperature gradient ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 5-Å column (Agilent, 25m x 0.25mm x 30μm). Hydrogen that evolved during the BPEC stabilization stage (see previous section ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were acquired on a Biotek Cytation 5 Multimode Reader (Agilent) with the same gains and exposure across all animals for each stain ...
-
bioRxiv - Systems Biology 2022Quote: ... and desalted via 5 μg C18 columns on an AssayMap (Agilent) following the standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... chamber slides were scanned with an automated microscope (Cytation 5, Agilent) with a 4x objective and filters for high-contrast brightfield and GFP fluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a carbohydrate column (4.6 × 150 mm, 5 μm, Agilent Technologies). The sugar concentrations were quantified according to a standard solution (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS ...