Labshake search
Citations for Agilent :
501 - 550 of 685 citations for 5 nitrobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Systems Biology 2024Quote: ... elav (Developmental Studies Hybridoma Bank, 9F8A9 at 1:20 and 7E8A10 at 1:5) and PCNA (DAKO, MO879, 1:500). For immunofluorescence studies ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 10-20 µl injection volume depending on protein concentration) were injected on a Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) at a flow rate of 100 µl/min using solvent A (0.1% formic acid and 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Molecular Biology 2021Quote: Cross-linked peptides were enriched with Fe(III)-NTA 5 µL in an automated fashion using the AssayMAP Bravo Platform (Agilent Technologies). Fe(III)-NTA cartridges were primed with 250 µL of 0.1% TFA in ACN and equilibrated with 250 µL of loading buffer (80% ACN/0.1% TFA) ...
-
bioRxiv - Genomics 2020Quote: ... gDNA before SRE treatment was diluted 5-fold and the undiluted solution after SRE treatment was used according to the protocol using TapeStation 2200 (Agilent Technologie) and Genomic DNA ScreenTape (Agilent Technologie).
-
bioRxiv - Genetics 2019Quote: ... All qRT-PCR experiments were performed on diluted cDNA (1:5 in nuclease-free water) using the Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and the 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
Quantitative proteomics reveals remodeling of protein repertoire across life phases of Daphnia pulexbioRxiv - Systems Biology 2019Quote: ... Pooled samples were desalted via C18 SPE on Sep-Pak cartridges as described above and subjected to basic pH reversed-phase liquid chromatography (bRPLC)[25] over a 4.6 mm x 250 mm ZORBAX Extend C18 column (5 μm, 80 Å, Agilent Technologies) with concatenated fraction combining as previously described ...
-
bioRxiv - Plant Biology 2020Quote: ... All samples were diluted to 3.5 % HNO3 prior to multi-elemental analysis using Inductively-Coupled Plasma Optical Emission Spectrometry (ICP-OES) (5100 ICP-OES, Agilent Technologies). The ICP-OES was equipped with a SeaSpray nebuliser and a double pass scott type spray chamber ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 μl of each sample containing approximately 10 μg of total native peptides and 500 fmol of each stable isotope-labeled standard (SIS) peptide were loaded on an analytical column, Zorbax 300SB-C18 (5 μm, 150 × 0.3 mm) (Agilent Technologies, USA) and washed with 5% acetonitrile for 5 min at a flow rate of 20 μl/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA was denatured at 95°C for 5 min in a PCR machine (PTC-200, MJ Research; PCR strip tubes (Agilent 410022)) and then incubated with the biotin capture RNA at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: The peptide was purified by high-performance liquid chromatography (HPLC) on a C4 column (Phenomenex Jupiter C4, 5 μm, 300 Å, 250 × 10 mm, Agilent) using an acetonitrile/water gradient containing 0.1% TFA ...
-
bioRxiv - Systems Biology 2021Quote: ... using an Aminex HPX-87H ion-exchange column operated at 60°C with 5 mM H2SO4 as the mobile phase with a flow rate of 0.6 mL min-1 (Agilent, Santa Clara). The OD660 was measured with a Jenway 7200 spectrophotometer (Jenway ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.25 μm film of 95% dimethyl/5% diphenylpolysiloxane) with a precolumn (10 m J&W integrated with Agilent 122-5532G) was used for compound separation ...
-
bioRxiv - Microbiology 2019Quote: ... Sample separation was done with a CP-PoraBOND Q column (50 m × 0.32 mm ID, 5 um film thickness; Agilent Technology, Netherlands) operated isothermally at 40°C using helium as a carrier gas at a flow rate of 2.0 ml/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The reaction was quenched by addition of glycerol (5% final) and desalted using a Bond Elut SepPak C18 cartridge (Agilent, MA). Methanol was used to elute oxidized GM1 species from the column and was removed by Speed Vac concentration (Savant) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were injected through a Zorbax Eclipse C8 4.6 x 150 mm 5 μm column (Agilent Technologies, Santa Clara, CA). Reference wavelengths for all three methods were set to 332 nm for TMZ and 273 nm for RG7388 ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3x 5 minutes) and incubated in the secondary antibody-horseradish peroxidase (HRP) complex as part of REAL EnVision detection system (Dako #K5007) for 1h at RT ...
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Samples were analyzed by UPLC-MS/MS at 5 µL injection volumes on a Zorbax RRHD Eclipse Plus C18 column (2.1×50mm, 1.8 μm; Agilent, Santa Clara, CA) using a Shimadzu Nexera X2 UHPLC (Shimadzu ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL of each sample was injected onto a ZORBAX SB-C18 column (5 μm, 4.6 × 250 mm) (Agilent 1260, USA). The mobile phase was composed of solvent A (water ...
-
bioRxiv - Biochemistry 2020Quote: ... [45] using an Agilent 1100 HPLC system fitted with a ZORBAX Eclipse XDB analytical C18 column (4.6×150 mm, 5 μm particle size, Agilent Technologies, USA). The bacteriocin protein was eluted using a 40-min linear water-ACN gradient (increasing the gradient to 95%).
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes (5×104 cells/well) were plated in a Seahorse XFe 24 microplate (Seahorse Biosciences/Agilent Technologies, Santa Clara, CA, USA) coated with 0.05mg/ml PDL and treated with 1 μM cisplatin or vehicle for 24h ...
-
bioRxiv - Immunology 2021Quote: ... sections were washed three times in 1 X PBS for 5 minutes and the sections allowed to dry slightly before mounting with DAKO mounting medium (Agilent Technologies) and allowing to airdry overnight in the dark at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tryptic peptides were re-dissolved in 10 μl 5% formic acid and 6 μl was injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies) followed by an initial wash step with Buffer A (5% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... washed three times in PBST containing 10 µg/ml DAPI for 5 minutes and mounted with a coverslip in fluorescent mounting media (Dako, S3023). All images were taken using a Zeiss LSM 710 confocal microscope and quantified manually using ImageJ software ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and melting temperatures Tm extracted as the maxima of the first derivatives of smoothened melting curves (filter 5) using the Cary WinUV software (Version 3.0, Agilent Technologies Inc.).
-
bioRxiv - Microbiology 2021Quote: ... the fractions were injected on HPLC for purification performed on an Eclipse+ C18 column (L = 150 mm, D = 3.0 mm, Particles diameter 5 µm) (Agilent, Waldbronn, Germany). The volume injected was 100 µl ...
-
bioRxiv - Genomics 2020Quote: ... 7890A apparatus equipped with a split/splitless injector and an FID detector with an HP-5 column (J & W Scientific Columns, Agilent Technologies) 30 m × 0.32 mm and 0.25 µm film thickness.
-
bioRxiv - Molecular Biology 2020Quote: ... Scanning of the microarrays was performed with 5 µm resolution and the extended mode using a ‘High Resolution Microarray Laser Scanner’ (G2505, Agilent Technologies). Raw microarray image data were extracted and analyzed with the ‘G2567AA Image Analysis / Feature Extraction software’ (Version A.10.5.1.1 ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Biochemistry 2022Quote: ... The resulting mixture was digested with DpnI and 5 µL of the mutagenesis reaction was transformed in XL10-Gold® Ultracompetent Cells (Agilent) and selected on amplicillin-containing LB-agar plates ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...