Labshake search
Citations for Agilent :
5101 - 5150 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Quality control of library templates was performed using a High Sensitivity DNA Assay kit (Agilent Technologies) on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... MIEG3 expression vectors containing IER5 mutations were generated by QuickChange II Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... Library quality was checked using a 2100 Bioanalyzer with the DNA High Sensitivity kit (Agilent Technologies). Sequencing of pooled libraries ...
-
bioRxiv - Immunology 2023Quote: ... Final ClickTag libraries and transcriptome libraries were analyzed on a BioAnalyzer high-sensitivity DNA kit (Agilent) and sequenced on Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2023Quote: ... RNA quality and quantity were assessed by Bioanalyzer using Agilent RNA 6000 Pico Kit (Agilent Technologies). Samples used for analysis had RIN ≥ 6.4 ...
-
bioRxiv - Physiology 2023Quote: ... MiRNAs were quantified using the smallRNA Analysis kit (DNF-470-0275) on a Fragment Analyzer (Agilent).
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (PacBio) ...
-
bioRxiv - Cell Biology 2023Quote: PARP14 point mutations were introduced through site-directed mutagenesis PCR using the QuickChange Lightning kit (Agilent) with primers described in Table 3 and confirmed by Sanger sequencing.
-
bioRxiv - Pathology 2023Quote: ... and its quality checked on a Bioanalyzer 2100 using RNA 6000 nano kit (Agilent Technologies, USA). Samples with RNA integrity number >=8.70 were selected.
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513), and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770 ...
-
bioRxiv - Biochemistry 2023Quote: ... Quality and quantity of total RNA was determined with DNF-471 RNA Kit −15 nt (Agilent) in the Fragment Analyzer 5300 (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We used a Femto Pulse system with an Ultra Sensitivity RNA kit (Agilent, #FP-1201-0275) to analyze quality control metrics.
-
bioRxiv - Cancer Biology 2022Quote: ... and S104T mutations were introduced by use of the QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) into the pHEBO-IRF4-HAtag expression construct according to the manufactureŕs recommendations and by use of primers indicated in Extended Data Table 6 ...
-
bioRxiv - Cell Biology 2023Quote: ... pShuttle constructs were subsequently transfected into HEK293A cells using the AdEasy adenoviral production kit (Agilent Technologies). The recombinant adenovirus was plaque purified ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial respiration was evaluated using the Seahorse XF Cell Mito Stress Test Kit (Agilent 103015-100) with the Seahorse XFe96 Analyzer (Agilent) ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations in WT hERG1a cDNA were made using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequence analysis ...
-
bioRxiv - Genomics 2022Quote: The average library length was assessed using the BioAnalyzer DNA High Sensitivity kit (Agilent, 5067-4626) on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2023Quote: ... and its integrity was determined by the Bioanalyzer 2100 kit (Agilent Technologies, Santa Clara, CA, USA). RNA libraries were prepared with the Illumina TruSeq TM RNA Sample Preparation Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The MLS-TFEB mutant was generated using the Quikchange XL site-directed mutagenesis kit (200521, Agilent). The ΔMTS mutant was generated by cloning a truncated sequence of TFEB in the pcDNA 3.1 FLAG backbone (121416 ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (Pacific Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample quality assessment/size was validated by Bioanalyzer DNA-High Sensitivity Kit (Agilent Technologies, #5067-4626).
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy3-labeled cRNA was synthesized and purified using the Low Input Quick Amp Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quality was determined with a Bioanalyzer 2100 using an RNA 600 Nano kit (Agilent, USA). High quality of RNA was used to prepare RNA-Seq libraries with NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality was controlled using Agilent rna 6000 nano kit (5067-1511, Agilent, Santa Clara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control of obtained libraries was done using Agilent Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... cultures were harvested and RNA extracted using Absolutely RNA Miniprep kit (Agilent Technologies, Santa Clara, CA) followed by additional DNAse treatment with Turbo DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA quality was assessed using the RNA 6000 Pico Assay kit (#5067-1513, Agilent Technologies). Two male medial prefrontal cortex samples (50 μg/kg Mixed BP and 150 μg/kg Mixed BP ...
-
bioRxiv - Biochemistry 2023Quote: ... Additional rounds of site directed mutagenesis using the QuikChange XL II site directed mutagenesis kit (Agilent) were applied to create Ptch1 KR (ATT/LIN)-His ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library quality was assessed with a BioAnalyzer 2100 using the High Sensitivity DNA kit (Agilent Technologies). The libraries were quantified using the Kapa Library Quantification Kit Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... All libraries were quantified with the Fragment Analyzer using the standard sensitivity NGS kit (Agilent Technologies) and pooled in equimolar concentrations and quantified with a Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using an RNA 6000 Nano kit (5067-1511, Agilent) on a 2100 Bioanalyzer from Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were visualized on an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies) and quantified using Qubit dsDNA HS DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and quantified using the Qubit dsDNA HS Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...