Labshake search
Citations for Agilent :
451 - 500 of 852 citations for Transglutaminase 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The peptides were then purified and concentrated using OMIX Tips C18 reversed-phase resin (Agilent Technologies, Santa Clara, CA, USA). The peptides were dehydrated in a vacuum centrifuge and analysed by NanoLC-MS/MS ...
-
bioRxiv - Immunology 2023Quote: Fluorophore-conjugated (or biotinylated) peptides were purified via reversed phase chromatography on a C18 column (Pursuit XRs C18 column, Agilent) to separate peptide-dye conjugates from unconjugated peptides or dyes ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested using a modified in-solution sample preparation protocol.94 One hundred micrograms of desalted peptides were fractioned on an microflow HPLC (1260, Agilent) using a XBridge peptide BEH C18 column (130 Å ...
-
bioRxiv - Systems Biology 2023Quote: ... equivalent amounts of each digested sample were pooled before proceeding to a peptide fractionation using a manual workflow based on Stage-Tips or an automatic workflow with the AssayMAP Bravo (Agilent).
-
bioRxiv - Plant Biology 2023Quote: ... and portions of samples corresponding to 5 µg of peptide were analyzed by nanoflow reverse-phase liquid chromatography-mass spectrometry using a 15 cm C18 Zorbax column (Agilent), a Dionex Ultimate 3000 RSLC nano-UPLC system ...
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
bioRxiv - Microbiology 2023Quote: ... Solid phase extraction of peptides was done using equilibrated C18 pipette tips (Bond Elut OMIX 100 µl pipette tips, Agilent). The samples are aspirated for 10 cycles for maximum binding efficiency and then eluted in LC-MS/MS vials with 100 µl of 0.1% TFA in water:acetonitrile (at a ratio of 30:70 (v/v)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... quenched samples were passed through a co-immobilized pepsin/fungal XIII protease column (1mm × 2cm) at 50 µl min−1 and the digested peptides were captured on a 1mm × 1cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Cancer Biology 2024Quote: ... enrichment of phosphorylated peptides was performed on the Bravo automated liquid handling platform using AssayMAP Fe(III)-NTA cartridges (Agilent). In brief ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibody detection was followed by 45 min of incubation with goat anti-mouse-biotin (DAKO, E0433, 1:200 in TNB blocking buffer) and subsequent incubation with Streptavidin-HRP Conjugate (PerkinElmer ...
-
bioRxiv - Neuroscience 2019Quote: ... Endogenous peroxides were quenched with 1 % hydrogen peroxide in 10 % methanol for 10 minutes followed by blocking in antibody diluent (Dako /S 202230) for 10 minutes ...
-
bioRxiv - Physiology 2019Quote: ... Endogenous peroxidase was blocked using the EnVision FLEX Peroxidase-Blocking kit followed by two washes for 5 min each (Dako wash buffer). Sections were incubated for 60 min with a rabbit anti-KCNN4 primary antibody (AV35098 ...
-
bioRxiv - Neuroscience 2021Quote: ... The slides were washed three times (3X) in TBST and incubated in blocking solution (Protein Block Serum-Free, Agilent DAKO, CA, USA) for 30 min at room temperature (RT) ...
-
bioRxiv - Neuroscience 2021Quote: ... The slides were washed three times (3X) in TBST and incubated in blocking solution (Protein Block Serum-Free, Agilent DAKO, CA, USA) for 30 min at room temperature (RT) ...
-
bioRxiv - Physiology 2021Quote: ... Primary antibodies are diluted in 1x blocking solution and incubated with antibodies against insulin (1:2000, guineapig, Dako, cat. no. A-0546), glucagon (1:500 ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Molecular Biology 2021Quote: Cross-linked peptides were enriched with Fe(III)-NTA 5 µL in an automated fashion using the AssayMAP Bravo Platform (Agilent Technologies). Fe(III)-NTA cartridges were primed with 250 µL of 0.1% TFA in ACN and equilibrated with 250 µL of loading buffer (80% ACN/0.1% TFA) ...
-
bioRxiv - Immunology 2022Quote: ... samples were acidified with formic acid (FA) and subsequently peptides were desalted using AssayMap C18 cartridges mounted on an AssayMap Bravo Platform (Agilent Technologies). Two biological replicates were pooled together to generate 100 micrograms of total peptide for TMT labeling and subsequent fractionation and phosphopeptide enrichment ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 μl of each sample containing approximately 10 μg of total native peptides and 500 fmol of each stable isotope-labeled standard (SIS) peptide were loaded on an analytical column, Zorbax 300SB-C18 (5 μm, 150 × 0.3 mm) (Agilent Technologies, USA) and washed with 5% acetonitrile for 5 min at a flow rate of 20 μl/min ...
-
bioRxiv - Physiology 2021Quote: ... This was used to extract mass isotope abundances (M0-M3) of each peptide from MS-only acquisition files with Mass Hunter Qualitative Analysis software (Agilent Technologies). Mass isotopomer distribution analysis (MIDA ...
-
bioRxiv - Cell Biology 2020Quote: ... This was used to extract mass isotope abundances (M0-M3) of each peptide from MS-only acquisition files with Mass Hunter Qualitative Analysis software (Agilent Technologies). Mass isotopomer distribution analysis (MIDA ...
-
bioRxiv - Biophysics 2020Quote: ... Peptides were trapped in a trap column (OPTI-TRAP for peptides, Optimize Technologies) and separated on a reversed-phase analytical column (PLRP-S for Biomolecules, Agilent Technologies) using a 27 min gradient of 8-40 % organic solvent (0.4 % formic acid in acetonitrile ...
-
bioRxiv - Biochemistry 2021Quote: ... The beads were then pulled down and the solutions containing the digested peptides were desalted using AssayMap C18 cartridges mounted on an AssayMap Bravo liquid handling system (Agilent Technologies) and subsequently dried down in a SpeedVac concentrator.
-
bioRxiv - Cancer Biology 2019Quote: 68Ga-labeled peptide was separated from non-radioactive NAPamide by reverse phase HPLC on an Agilent 1200 system (Agilent, Waldbronn, Germany). The complete mixture from the reaction chamber was loaded on an Eclipse XDB-C18 bonded silica column (Agilent ...
-
bioRxiv - Physiology 2020Quote: ... This was used to extract mass isotope abundances (M0-M3) of each peptide from MS-only acquisition files with Mass Hunter Qualitative Analysis software (Agilent Technologies). Mass isotopomer distribution analysis (MIDA ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then desalted for 5 min at 30 μl/min using 0.1% formic acid and the peptides were then eluted onto an analytical nano-HPLC column (150 mm × 75 μm 300SBC18, 3.5 μm, Agilent Technologies, USA) at a flow rate of 300 nL/min ...
-
bioRxiv - Physiology 2021Quote: ... This was used to extract mass isotope abundances (M0-M3) of each peptide from MS-only acquisition files with Mass Hunter Qualitative Analysis software (Agilent Technologies). Mass isotopomer distribution analysis (MIDA ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Synthetic Biology 2022Quote: ... The peptides were purified by reverse-phase (RP)-HPLC using a preparative Agilent 1260 Infinity II Series HPLC-system (Agilent Technologies) with column 1 (Supplementary Table 13) ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... TMT-labeled peptides were then separated by high pH reverse-phase high performance liquid chromatography (HPLC) with C18 columns (Agilent BioTek) and dried in a vacuum centrifuge ...
-
bioRxiv - Plant Biology 2023Quote: ... One hundred micrograms of precipitated protein sample were digested with trypsin and 30 µg of the resulting peptides desalted with PepClean C-18 Spin Columns (Agilent Technologies) according to manufacturer recommendations as previously described (Martinez-Marquez et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... The digestion was quenched with 10% formic acid (FA) and the resulting peptides were cleaned-up in an automated fashion using the AssayMap Bravo platform (Agilent Technologies) with a corresponding AssayMap C18 reverse-phase column ...
-
bioRxiv - Biophysics 2024Quote: ... Later the peptide was purified using reverse-phase high- performance liquid chromatography (HPLC) using C18 column in an HPLC instrument (Agilent Technologies). The pure peptide was lyophilized from water and was characterized using matrix-assisted laser desorption/ionization mass spectrometry.
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Neuroscience 2022Quote: ... and incubated overnight on a shaker at room temperature in fresh blocking solution with polyclonal rabbit anti-GFAP (1:1000, Dako, Santa Clara, CA). The following day tissue was washed in PBST and incubated for 2.5h at room temperature with Alexa Fluor 488 donkey anti-rabbit secondary (1:500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... onto a peptide trap (Zorbax 300 SB-C18, 0.3 i.d. × 5 mm, 5 µm, 300 Å; Agilent Technologies, Santa Clara, CA, USA) for concentration and desalting with a pump running in isocratic mode with 0.1% formic acid in water ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein or peptide (fragments of peptide) intact mass was acquired using an MSD-ToF electrospray ionisation orthogonal time-of-flight mass spectrometer (Agilent Technologies Inc.). Data analysis was performed using MassHunter Qualitative Analysis Version B.07.00 (Agilent ...