Labshake search
Citations for Agilent :
451 - 500 of 3001 citations for Inactive tyrosine protein kinase 7 PTK7 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... Rabbit anti-mouse immunoglobulin-HRP and goat anti-rabbit immunoglobulin-HRP were bought from Dako, Amsterdam ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Microbiology 2020Quote: Proteins were detected using the following primary antibodies: anti-enterovirus VP1 clone 5-D8/1 antibody purchased from Dako (Denmark); Mouse anti-Ub ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with secondary antibody polyclonal rabbit anti-mouse HRP-conjugate (cat.P0260, Dako, Agilent Technologies, Santa Clara, CA, USA) diluted 1:100 in PBS 1× for 1h at room temperature (RT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 drops per slide of secondary antibody (EnVision + labeled polymer-HRP anti-mouse, Dako K4001, or anti-rabbit, Dako K4003) were added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 drops per slide of secondary antibody (EnVision + labeled polymer-HRP anti-mouse, Dako K4001, or anti-rabbit, Dako K4003) were added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-conjugated secondary antibodies were then incubated on slides for 1-hour and detected with the DAB+ chromogen kit (DAKO). After washing ...
-
bioRxiv - Neuroscience 2021Quote: ... A corresponding anti-rabbit or anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody at a dilution of 1:7000 (Dako) or 1:2000 (Pierce ...
-
bioRxiv - Physiology 2021Quote: ... sections were incubated with secondary HRP coupled antibodies followed by addition of DAB+ Substrate Chromogen System (Dako Omnis, Glostrup, Denmark). For each experiment ...
-
bioRxiv - Pathology 2022Quote: ... appropriate HRP-coupled secondary antibodies (rabbit anti-mouse, Cat. No. P0260, and goat anti-rabbit, Cat. No. P0448, from DAKO and rabbit anti-goat ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were washed with TBS + 0.1% Tween 20 and then incubated for 1h at RT with the following secondary antibodies diluted in blocking buffer: swine anti-rabbit Ig HRP-conjugated (1:3000, catalog no. P0399, Dako) or goat anti-mouse Ig HRP-conjugated (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... the membranes were washed three times with TBS-T and incubated for 1 hour with HRP-conjugated secondary antibodies (Dako). Proteins were detected by enhanced chemiluminescence reagents (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The membranes were washed and incubated with secondary swine anti-rabbit HRP conjugated antibody (Agilent DAKO, Santa Clara, CA, P0399) in 1% milk in PBST for 1 hour at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... The membranes were washed and incubated with secondary swine anti-rabbit HRP conjugated antibody (Agilent DAKO, Santa Clara, CA, P0399) in 1% milk in PBST for 1 hour at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2022Quote: ... Slides were washed in PBS and incubated with horseradish peroxidase (HRP) conjugated secondary antibody included in the peroxidase substrate kit (Dako EnVision + System HRP labelled polymer anti-mouse or anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2020Quote: ... we used horseradish peroxidase (HRP)-conjugated goat anti-rabbit and goat anti-mouse secondary antibodies (diluted 1:200 in PBS; DAKO) to bind the primary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed thrice in PBS and incubated for 30 min with HRP-conjugated rabbit anti-mouse antibody (DaKo, P0161) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... After washing with TBST three times, membranes were exposed to appropriate secondary antibodies (anti-rabbit, anti-mouse, and anti-rat) coupled to HRP (Dako) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... and probed with 8ng/mL anti-calnexin antibody (Cat. No. 2433S, Cell Signalling) overnight followed by 25ng/mL goat anti-rabbit -HRP (Cat. No. P0448, Agilent) secondary antibody or with 600ng/mL anti-GAPDH directly conjugated with HRP (Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Cancer Biology 2024Quote: ... Sections were then rinsed with Wash Solution and incubated for 30 min with anti-rabbit EnVision+ HRP-labelled polymer secondary antibody (K4003, Agilent), except for p21 where an anti-rat ImmPRESS secondary antibody was applied ...
-
bioRxiv - Cancer Biology 2024Quote: ... Signal amplification was facilitated using the Dako envision + system-HRP labeled polymer anti-rabbit antibody (Agilent Technologies, Santa Clara, CA). Color development was achieved using 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was washed three times in block buffer followed by a 1 h incubation with anti-goat/-rabbit HRP-conjugated secondary antibodies (1:5000, Agilent Dako) at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal rabbit anti-mouse secondary antibody IgG/HRP (P0260; Agilent Technologies/Dako) diluted 1:2000 in 3% BSA.
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 20 minutes at room temperature with an anti-rabbit antibody coupled with horseradish peroxidase (HRP) (Flex, Dako). Finally ...
-
bioRxiv - Physiology 2023Quote: ... Membranes were then washed in TBST and incubated with the secondary HRP-conjugated antibodies: goat anti-rabbit (1∶1000, P0448, DAKO) or polyclonal anti-mouse (1∶2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Signal amplification was achieved using the Dako envision+ system-HRP labeled polymer anti-rabbit antibody (Agilent Technologies, Santa Clara, CA), followed by color development with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... The tissue was washed twice in TBS-T prior incubation with secondary antibody (EnVision anti-mouse-HRP/DAB+ system, Agilent), 3,3′-Diaminobenzidine (DAB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were washed 3 times with 500 µL PBS before the addition of the secondary antibody (HRP-conjugated anti-mouse IgG (1.5mg/mL) (Dako, Denmark)) diluted 1:2000 in 1% BSA PBS for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... Slides were incubated with the primary antibody overnight and specific bonds were visualized using an HRP conjugated streptavidin and polymerized 3,3ʹ-diaminobenzidine (Dako, K3468). Nuclei were counterstained with Mayer’s Hemalum solution (Merck ...
-
bioRxiv - Immunology 2024Quote: ... Slides were incubated with the primary antibody overnight and specific bonds were visualized using HRP conjugated secondary antibody against rat IgG and polymerized 3,3ʹ-diaminobenzidine (Dako, K3468). Nuclei were counterstained with Mayer’s Hemalum solution (Merck 1.09249.05).
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: The following secondary antibodies were used in this study: rabbit anti-mouse immunoglobulins/HRP (Agilent Cat# P0260, RRID:AB_2636929, 1/10000), goat anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibody incubation was performed for 1 h at RT with Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (1:5000, Dako) or Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP (1:5000 ...
-
bioRxiv - Biochemistry 2024Quote: ... the peptide arrays were incubated with a 1:1,000 dilution of an appropriate antibody peroxidase conjugate (anti-rabbit immunoglobulins HRP conjugate, DAKO, P0217) for one hour at 25°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The CD22 point mutations from tyrosine to phenylalanine were introduced by site-directed mutagenesis according to the QuikChange method (Agilent, Santa Clara, USA).
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Immunology 2020Quote: ... membranes were incubated with secondary Abs (goat anti-rabbit HRP or rabbit anti-mouse HRP; DAKO, Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The immunohistochemical staining was revealed with HRP labeled polymer (EnVisio+ Dual Link System HRP, K4061, Agilent) and the diaminobenzidine HRP chromogen (DAB+ liquid ...
-
bioRxiv - Cell Biology 2022Quote: ... or α-rabbit-HRP (P0447, Dako). Blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific ...