Labshake search
Citations for Agilent :
451 - 500 of 2036 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of TEDAP (4 μM) underwent reverse-phase HPLC (Agilent PLRP- S reversed phase column 3.0 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... tocochromanols in 20 μL of supernatant were separated by an HPLC 1100 system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.05% Tween-20) and incubated with HRP-conjugated secondary antibody (1:1500, #P0260, Agilent) for 1h at RT ...
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Sample showing a broad distribution of DNA 20-100 kbp on Femto Pulse (Agilent) was selected to proceed ...
-
bioRxiv - Bioengineering 2022Quote: ... using a HP-PLOT/Q column (30 m × 0.32 mm, 20 μm) from Agilent Technologies and nitrogen as the carrier gas ...
-
bioRxiv - Cancer Biology 2023Quote: Bioenergetics of washed platelets (20 × 106/well) were determined by Seahorse XFe96 (Agilent Technologies) as previously described (54) ...
-
bioRxiv - Developmental Biology 2023Quote: ... antigen retrieval was performed by boiling slides for 20 min in citrate buffer (Dako). Sections were incubated in primary antibody solution at the appropriate dilution overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: Samples were removed from the −80°C freezer and allowed to warm to room temperature then vortexed for approximately 1 minute before being placed into the autosampler and held at 24°C (Agilent 1100 series autosampler, Palo Alto, CA) for the LC/MS/MS analysis ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10 mM Glucose (Agilent, 103577), 2 mM Sodium Pyruvate (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-CK17 (1:10, Dako, M7046), mouse anti-MMP7 (1:100 ...
-
The Batten disease protein CLN3 is important for stress granules dynamics and translational activitybioRxiv - Molecular Biology 2022Quote: ... and 10 mM glucose (Agilent # 103681-100). Oligomycin and FCCP were reconstituted to concentrations of 10 μM and 5 μM ...
-
bioRxiv - Immunology 2020Quote: ... and treated with glucose (10 mM; Agilent), Oligomycin (1.5 μM) ...
-
Independent somatic evolution underlies clustered neuroendocrine tumors in the human small intestinebioRxiv - Genomics 2021Quote: ... anti-serotonin (H209; Dako; diluted 1:10) and anti-SSTR2 (UMB-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL OMIX C18 tips (Agilent Technologies) were used for desalting and microextraction of tryptic peptides ...
-
bioRxiv - Microbiology 2022Quote: ... coli Ultracompetent cells (XL-10 gold, Agilent) and plated onto Amp+ LB plates ...
-
bioRxiv - Neuroscience 2022Quote: ... or XL-10 Gold (Agilent Technology, 200314) competent cells were used for plasmid amplification.
-
bioRxiv - Cancer Biology 2022Quote: ... Counterstaining was performed with 10% haematoxylin (Dako) and after dehydration slides were mounted with DPX mounting medium (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... and additional 10 mM glutamine (Agilent, 103579).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... MassHunter Quant software version 10 from Agilent was used for data processing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10 mM glucose (Agilent, 103577-100). Cells were then placed into a non-CO2 humidified incubator at 37°C for 60 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 3,3’-diaminobenzidine substrate for 10 minutes (DAKO) and counter stained for 5 minutes with automated hematoxylin (DAKO) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 mM glucose (Agilent Technologies, UK), and myoblasts were incubated at 37°C in a non-CO2 incubator 1 hour prior the experiment ...