Labshake search
Citations for Agilent :
451 - 500 of 1719 citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and retention time (RT) were imported into a personal compound database and library (PCDL Manager, version B.07.00, Agilent Technologies) used in data processing workflow.
-
bioRxiv - Cell Biology 2022Quote: ... The SEC24A B- and C-site mutants were generated on pcDNA3.1-SmBiT-SEC24A using QuickChange site-directed mutagenesis (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the NF-κB and IRF binding sites in pLTR(Sp1)-luciferase were generated using the QuickChange IIXL site-directed mutagenesis kit (Stratagene). Primers used for site-directed mutagenesis are listed in Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... of target compounds were detected using the ‘find compound by formula’ function and analyzed by Masshunter qualitative and quantitative analysis software version B.07.00 (Agilent technologies). For untargeted analysis ...
-
bioRxiv - Genomics 2021Quote: ... The gel-like image of the 2100 Bioanalyzer result was visualized using the 2100 Expert Software (ver. B.02.11, Agilent Technologies) in pseudo colors with default settings ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Biophysics 2022Quote: ... and we checked that we obtained a DTCCSHe within 785-791 Å2 of its previously determined value (788 Å2).23 The data were extracted using the IM-MS Browser software version B.08.00 (Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... Seahorse XF Cell Culture Microplates were pre-treated with poly-D-lysine and 106 primary B cells or 105 DG75 cells were plate in Seahorse XF Base Medium (Agilent) supplemented with 2mM L-glutamine (Agilent) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... to assess levels of serum psilocin and 2C-B (ng/mL) using liquid chromatography-tandem mass spectrometry liquid chromatography-tandem mass spectrometry (LC-MS/MS; Agilent, Waldbronn ...
-
bioRxiv - Molecular Biology 2023Quote: ... raw LC/MS data was processed by the Molecular Feature Extractor algorithm of MassHunter Qualitative Analysis software B.07.00 (Agilent Technologies). A list of all N-glycans was extracted using previously optimized application of spatial mouse brain glycome database35 ...
-
bioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (45) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) in order to obtain peak information including m/z ...
-
bioRxiv - Cell Biology 2022Quote: Raw LC-MS/MS data were processed using the Agilent Quantitative analysis software (version B.07.00 MassHunter, Agilent Technologies, USA). Relative quantification of metabolites was based on Extracted Ion Chromatogram (EIC ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were injected and separated via gas chromatography on an Agilent 7890 B gas chromatograph (Agilent, Santa Clara, CA, U.S.A.). Coupled to this was a Pegasus HT TOFMS mass spectrometer (Leco Corporation ...
-
bioRxiv - Physiology 2023Quote: ... Some 20 μl of re-dissolved potion (b) and portion (c) solutions were then loaded into injection vials an injection vial (cat. 9301-0978, Agilent Technologies ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan)13 and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information including m/z ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... using automatized integration of the peak area of each compound and standardization of the amount of each peak to its closest internal standard eluting before (MassHunter Workstation, Quantitative Analysis B.07.00 [Agilent Technologies]), thereby correcting for possible injection differences ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...