Labshake search
Citations for Agilent :
451 - 500 of 4000 citations for 7 Butyl 8 mercapto 1 3 dimethyl 3 7 dihydro purine 2 6 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Immunology 2019Quote: ... pH 6 (Dako Cytomation) and set to 125°C with 30 s at the maximal pressure set to 10 psi ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 6 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Immunology 2020Quote: ... CK5/6 (Dako/IR780), p40 (Zytomed/MSK097) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Pyruvate and 2 mM Glutamine (Agilent; 103015-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-GFAP (1:5,000, Dako, Z033401-2). The next day ...
-
bioRxiv - Immunology 2021Quote: ... stained with hematoxylin (Agilent, S330930-2, 1 mL), and incubated at room temperature for 7 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-CD31 (1:200 dilution, M082329-2, Dako), Goat anti-Rabbit IgG Cross-Adsorbed Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Gfap (1:1000, Agilent #Z033401-2); rabbit anti-alpha-Sma (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Visualizations of the primary antibodies were achieved using suitable secondary antibodies conjugated with Alexa fluorophores (Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Genomics 2023Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4x2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... 8 µm HPLC column (Agilent Technologies). Samples of culture supernatants were diluted twice with milliQ water with 50 mM H2SO4 ...
-
bioRxiv - Genetics 2023Quote: ... or goat serum (DAKO, cat.no.X090210-8), followed by incubation with primary antibody (overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 µm HPLC column (Agilent Technologies). Analyses were performed using the following conditions ...
-
bioRxiv - Immunology 2019Quote: ... RP1-5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ and RPI1-5’-CAA GCA GAA GAC GGC ATA CGA GAT CGT GAT GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ and the purified library was quantified with 4200 TapeStation (Agilent Technologies) and paired-end sequenced on a Nextseq 500 V2 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... The PAM sequences in the c(3)G gene were mutated using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology). The bases changed are in bold above ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted cells by the centrifugation for 3 min at 300 rcf are stained with FITC-conjugated anti-lysozyme antibody (Dako, F0372) and APC-conjugated anti-CD24 antibody (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: Measurements in both settings were performed in 3 min mix and 3 min measure cycles at 37 °C in six replicates per condition on a Seahorse XFe96 Analyzer (Agilent Technologies). OCR and ECAR were depicted as pmol/min and mpH/min ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Immunology 2021Quote: ... HES5 and GATA6 genes were made for 3 replicates using the Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technologies) and analyzed on a CFX Opus Real-Time PCR system (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Biophysics 2021Quote: ... then was injected to online SEC-SAXS equipped with a temperature-controlled (15 °C) silica-based SEC column (Agilent BioSEC-3)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... heat mediated antigen retrieval was performed for 3 min at 125°C in citrate pH 6.0 target retrieval solution (Dako Cat# S2369) using a decloaking chamber (Biocare Medical) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were read at 450 nm and 560 nm wavelengths using a BioTek Cytation 3 Cell Imaging Multi-Mode Microplate Reader (Agilent Technologies). Plasma samples isolated from retroorbital bleeds were used for ProcartaPlex immunoassays (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...