Labshake search
Citations for Agilent :
451 - 500 of 3983 citations for 6 Chloro 4 hydroxy 3 methoxycarbonyl 2H thieno 2 3 e 1 2 thiazine 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... MyoD (Dako; 1: 1,000), MyoG (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... 1 μM Olygomycin (Agilent), 1 μM FCCP (Agilent) ...
-
bioRxiv - Immunology 2022Quote: ... 1 μM FCCP (Agilent), 0.5 μM antimycin A/rotenone (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... MBP (1:500; DAKO) and actin (1:1000 for cerebellum ...
-
bioRxiv - Immunology 2023Quote: ... CD3 1:250 (Dako, #A0452 ...
-
bioRxiv - Pathology 2023Quote: ... GFAP (DAKO; 1:6000), Iba1 (Wako ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM pyruvate (Agilent), 2 mM glutamine (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM pyruvate (Agilent), 2 mM glutamine (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... MHCII (Dako 1:50), MOG Z12 (inhouse clone 1:5074) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Ki67 (1:250, Dako), GH (1:250 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Immunology 2019Quote: ... Ms CFH-Santacruz, sc-166613, 1: 50, Rb CXCR4, sc-9036, 1:50, Rb CD11b, CST,49420, 1:200, Rb GFAP, Dako, Z0334). After washing thrice with 1x PBS and the sections were incubated with appropriate fluorescent labelled secondary antibodies (Goat anti Rb594,Life Tech ...
-
bioRxiv - Microbiology 2022Quote: ... For visualising HSV-1 plaques mouse anti-gD (LP2) 1:50 [75] and HRP-conjugated rabbit anti-mouse 1:5000 (DaKo, P0161) were used.
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies to the following proteins were used at the indicated concentrations: ubiquitin (1:1000, P4G7, BioLegend; 1:200 Cell Signaling; 1:200, Z0458, Dako), GABARAP (1:1,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were then incubated overnight at 4 °C with appropriate dilution of anti-Ki67 (1:100, Dako, M7240) in TBS containing Horse Serum (2%) ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary incubation was performed overnight at 4°C (phospho-Ser129, BioLegend Cat # 825701, 1:2000; GFAP, DAKO Cat # GA524 ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP; Z0334, Dako, 1:20000/1:100000), rabbit anti-glutamine synthetase (GS ...
-
bioRxiv - Neuroscience 2022Quote: ... Ki67 (1:1000) and glial fibrillary acidic protein (GFAP) (1:1500) from Dako Cytomation (Glostrup ...
-
bioRxiv - Immunology 2023Quote: ... and anti-CD68/CD206 in a 1:20/1:100 dilution (Dako/Sigma). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1 hour and immunostaining was visualized with 3’3-diaminobenzidine (1:100; Dako) incubation for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EnzoLife Science, 1:1000), anti-tubulin (mouse, available inhouse, 1:10000) and HRP-conjugated secondary antibodies anti-rabbit (goat, Dako, 1:2000), anti-mouse (goat ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...