Labshake search
Citations for Agilent :
451 - 500 of 4458 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM glutamine (Agilent 103579-100), and 10 mM glucose (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Citrate pH 6 (Dako, S236984-2) at 100°C for CD206 and CD86 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Immunology 2022Quote: ... Quality control of the libraries to ensure no adapter dimers were present was carried out by examining 1ul of a 1:5 dilution on a High Sensitivity DNA chip (Agilent Technologies: 5067-4626) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes were washed three times with TBS-T for 5 min and incubated for 1 h at room temperature with anti-rabbit immunoglobulin/HRP secondary antibody (Agilent, Santa Clara, CA) or with anti-mouse IgG-Peroxidase secondary antibody (MilliporeSigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Neuroscience 2024Quote: ... blocked and permeabilized with 5% goat serum (Dako) and 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm (Agilent Technologies, Santa Clara, CA, USA) under isocratic conditions (0.1 M sodium acetate buffer ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Microbiology 2024Quote: ... Clarified supernatant (2 µl) was dotted onto nitrocellulose as above and probed with rabbit polyclonal anti-CEA primary antibody (1:1000; Dako, Denmark A0115) and HRP conjugated anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... Stimulated BMDMs were washed with XF media (non-buffered RPMI-1640 containing 2 mM L-glutamine and 1 mM sodium pyruvate; Agilent Seahorse XF24) and incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1:2 dilution series in serum-free media was performed and cells were infected in a 96-well plate (Agilent, 204624-100) for 1 hour at 37°C followed by addition of methylcellulose (Sigma M0512-500G ...
-
bioRxiv - Neuroscience 2024Quote: ... Wildtype mouse brain paraffin sections were used for IHC analysis with a dilution of mouse serum at 1:200 with antibody diluent solution (DAKO, S080983-2). Mouse anti-NMDAR1 monoclonal antibody (BD ...
-
bioRxiv - Cell Biology 2024Quote: ... on a Dako Omnis platform for 1 h and secondary antibody for 30 minutes followed by substrate chromogen (DAB) (DAKO, GV82511-2) treatment for 10 minutes and counterstaining with haematoxylin ...
-
bioRxiv - Cell Biology 2024Quote: ... on a Dako Omnis platform for 1 h and secondary antibody for 30 minutes followed by substrate chromogen (DAB) (DAKO, GV82511-2) treatment for 10 minutes and counterstaining with haematoxylin ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Plant Biology 2024Quote: ... Amino acid contents were measured using a triple quadrupole LC-MS/MS system (Agilent 6420, CA, USA) with a Discovery HS-F5 column (2.1 × 250 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... Bond Elut PBA (phenylboronic acid) cartridge and 96-well plate were purchased from Agilent (Santa Clara, USA). 1 µM of q and Q was spiked in human plasma and extracted with SPE cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... and dispensed 30% acetic acid using the BioTek EL406 microplate washer/dispenser (Agilent, Santa Clara, CA, USA). The absorbance of CV-stained biofilms was recorded at 590 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody solution was then washed out 3x with TBS-T and TBS-T + 5% NFDM + 1:2000 Dako goat anti-rabbit or anti-mouse HRP-conjugated immunoglobulins (Agilent, Santa Clara, CA, USA) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...