Labshake search
Citations for Agilent :
451 - 500 of 4022 citations for 1 Boc 4 chloro 5 formyl 3 6 dihydro 2H pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and luminescence measured on a Cytation 5 instrument (Agilent). The luminescence inhibited by Z-YVAD-FMK corresponds to specific caspase-1 activity ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were imaged using Biotek Cytations 5 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence was measured using the Cytation 5 (Agilent Technologies).
-
bioRxiv - Developmental Biology 2021Quote: ... The antigen retrieval was achieved with 3 min proteinase K treatment (S3020, Agilent), and the sections were washed in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... both packed with Polaris C18-A 3-μm material (all from Agilent Corp.). After injection of the sample onto the trapping column ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... Agilent SEC-3 300-Å HPLC column (Agilent Technologies, cat. no. 5190-2511) was used to purify tRNA from total RNA with a temperature-controlled column compartment at 40 °C with 100 mM ammonium acetate aqueous phase at a flow rate of 1 ml/min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... The column used was Bio-SEC-3 130 Å 4.6/300 (Agilent Technologies). All samples were run in 20 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... The size exclusion analytical column (Bio-SEC-3, Agilent, Santa Clara, CA, USA) was loaded with 50-µl of protein at a concentration of 3.0 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... with a guard column Zorbax Extend C18 (3 × 5mm, 1.8μm; Agilent, Waldbronn, Germany), both maintained at 60°C ...
-
bioRxiv - Cancer Biology 2024Quote: 3 µm thin TMA sections were mounted on Flex microscope slides (Agilent Technologies) and dried at room temperature (RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of TEDAP (4 μM) underwent reverse-phase HPLC (Agilent PLRP- S reversed phase column 3.0 μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... (Mildford, MA, USA) and vacuum manifold system (VacElut 6 Manifold Processing Station, Agilent Technologies, Santa Clara, CA, USA) were used for solid-phase extraction (SPE).
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions have been obtained by mutating 6 bp of the siRNA-targeting sequence using Quickchange (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... MNase-digested samples were loaded on 6% PAGE and stained with SybrGOLD and run on a Bioanalyzer (Agilent) using DNA High sensitivity chips ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...