Labshake search
Citations for Agilent :
451 - 500 of 3450 citations for ± trans 1 Boc 4 4 pyridinyl pyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... fatty acid oxidation was assessed by using the Seahorse XF24 Analyzer (Agilent Technologies) to measure mitochondrial respiration ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fatty acids were dosed from the autosampler of a GC (Agilent 7890A) as pulses to the front inlet packed with the catalyst bed (maintained in the range 250-400 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: Organic acids and ethanol were measured by high-performance liquid chromatography (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Bioengineering 2020Quote: ... butyric acid and glucose were measured using a high-performance liquid chromatography (HPLC, Agilent Technologies 1260 Infinity series ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.
-
bioRxiv - Synthetic Biology 2023Quote: ... Residual sugars and organic acids were measured using a HPLC 1100 (Agilent Technologies, USA) equipped with an Aminex 75H column with 4 mM sulfuric acid as the mobile phase at 0.6 mL/min and analyzed using a refractive index detector (RID).
-
bioRxiv - Biophysics 2022Quote: ... Nucleic acid purification was performed using a high-performance liquid chromatography (HPLC, Agilent 1100) equipped with a diode array detector ...
-
bioRxiv - Physiology 2024Quote: ... Amino acid substitutions were introduced via site-directed mutagenesis with the QuikChange method (Stratagene). Channels were truncated by replacing the respective amino acid triplet by a stop codon and appropriate restriction site ...
-
bioRxiv - Bioengineering 2024Quote: ... Standards and a HPLC column (AdvanceBio Amino Acid Analysis column) were purchased from Agilent. The amino acids were derivatized with OPA for primary amino acids and FMOC for secondary amino acids as per the protocol provided by Agilent ...
-
bioRxiv - Bioengineering 2024Quote: Amino acid analysis was performed using a GC-MS/MS instrument (Agilent Technologies, USA) equipped with an autosampler ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: Substitutions of S amino acids were introduced using Quikchange Lightning Site-Directed Mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... AMP-derivatised fatty acids as [M+H]+ were aligned using Mass Profinder v10.0 (Agilent Technologies) with an RT tolerance of 0.5 min and MS1 tolerance of 10 ppm ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...