Labshake search
Citations for Research Products International :
301 - 350 of 637 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and subsequently plated on LB-agar plates (Research Products International) with the appropriate antibiotic selection marker. ...
-
bioRxiv - Plant Biology 2023Quote: ... Resuspended cells were transferred to a cryotube with 300 mg of 0.1 mm zirconia/silica beads (Research Products International, 9833), and lysed using Mini-Beadbeater-16 (BioSpec ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The SC base medium (per liter: 2g US Biological Drop-out Mix Complete, 6.7g RPI yeast nitrogen base) was supplemented with either 1.5% D-glucose (RPI ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was supplemented with either 1.5% D-glucose (RPI) (Glu) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1.5% D-galactose (RPI) (Gal) ...
-
bioRxiv - Microbiology 2023Quote: ... D-Glucose anhydrate from Research Products International (DPI, Prospect, IL, USA), and C6-rich wood sugars from Fibenol OÜ (Imavere ...
-
bioRxiv - Microbiology 2023Quote: ... washed with TBS-T (Research Products International T60075-4000.0 with 0.1% Tween 20 ...
-
bioRxiv - Genomics 2023Quote: ... all protocol workstations and equipment were cleaned using RNase Away (RPI 147002) followed by 70% Isopropanol ...
-
bioRxiv - Microbiology 2023Quote: ... and trimethoprim-sulfamethoxazole (RPI, Mount Prospect, IL; Chem-Impex) were prepared according to Clinical and Laboratory Standards Institute (CLSI ...
-
bioRxiv - Microbiology 2023Quote: ... and vancomycin HCl (Research Products International), ciprofloxacin (Sigma Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: DTT was purchased from Research Products International (Mount Prospect, USA) and was made fresh for every experiment ...
-
bioRxiv - Cell Biology 2023Quote: ... Leupeptin (1 µg/ml) (all RPI, catalog numbers A20550 ...
-
bioRxiv - Cell Biology 2023Quote: ... and PMSF ([Phenylmethylsulfonyl fluoride] 1mM final, RPI P20270 ...
-
bioRxiv - Cell Biology 2023Quote: ... and PMSF ([Phenylmethylsulfonyl fluoride] 1mM final, RPI P20270 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% BSA (Research Products International, 9048-46-8) 30min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... and finally blocked with 2% BSA (Bovine Serum Albumin, Research Products International, 9048-46-8) 30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... Leupeptin (1 µg/ml) (all RPI, catalog numbers A20550 ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTag libraries were constructed with custom P5_TSO_hybrid primer50 and custom P7_TruSeq-6bp-Unique-Index_EGFP primer (CAAGCAGAAGACGGCATACGAGAT[6bp-RPI]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGGCATGGACGAGCTGTACAAGT*A*A ...
-
bioRxiv - Cell Biology 2023Quote: All sN&B acquisitions were analyzed using custom 2015 MATLAB scripts (Sylvain Tollis, University of Montreal with edits from Steven Notley and Catherine Royer, RPI), which has previously been used to determine absolute concentration of fluorescent proteins in live cells (6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Bovine serum albumin (BSA) and dry milk powder are from Research Products International. SNAP-Surface Alexa Fluor 546 (S9132S) ...
-
bioRxiv - Cell Biology 2023Quote: ... Tritech research) with 10.5 mL nematode growth media (NGM) (23 g Nematode Growth Medium (Legacy Biologicals, a division of Research Products International (RPI)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% BSA (Research Products International, 9048-46-8) 30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... then blocked with 2% BSA (Bovine Serum Albumin, Research Products International, 9048-46-8) 30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... The PVDF membranes were incubated overnight at 4◦C in 2% BSA (Research Products International, 9048-46-8) with primary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... A circle was drawn using a PAP pen (RPI) around the solution droplet to avoid spilling ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% bovine serum albumin (BSA, Research Products International), 0.3 M glycine (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... KANR and NATR marked gene replacements were confirmed by growth on YPD containing G418 (200 µg/ml; Research Products International) or nourseothricin (100 µg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... Adenosine 5’-triphosphate disodium salt hydrate (ATP) was purchased from Research Products International (Mount Prospect, IL, USA). Suc-LLVY-AMC (chymotrypsin-like activity substrate ...
-
bioRxiv - Immunology 2023Quote: ... The cultures were diluted 1:100 in Terrific BrothTB media (RPI) supplemented with kanamycin and grown at 37 °C to an OD600 of ∼0.6 ...
-
bioRxiv - Immunology 2023Quote: ... Cultures were diluted 1:100 in Terrific Broth (TB) media (RPI) supplemented with kanamycin and grown at 37C to an OD600 of ∼0.6 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% Triton X-100) containing 2X protease (Protease Inhibitor Cocktail III, RPI) and phosphatase inhibitors (Halt Phosphatase Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 2x amount of protease (cocktail III, RPI) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Biophysics 2023Quote: ... the cells were stained with 200 μL of 5 mg/mL solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stain (Research Products International) in PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... acrylamide (50 mg, RPI Cat. No. A11260), bis-acrylamide (6 mg ...
-
bioRxiv - Bioengineering 2023Quote: ... bis-acrylamide (6 mg, RPI, Cat. No. A11270), and acrylic acid (7.4 μL ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we supplemented the Glu medium with either 0.5M sodium chloride (RPI) (NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... phosphatase inhibitor cocktail III (Research Products International, P52104-1), vortexed at maximum speed and centrifuged at 4°C at 16,000 g for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Bottles were autoclaved and vitamins were syringed in from a filter sterilized (RPI 256131) 1X stock just before inoculation.
-
bioRxiv - Biochemistry 2022Quote: ... The membrane unit was placed in 2mL scintillation fluid (RPI, IL) and counted using a liquid scintillation counter (Beckman ...
-
bioRxiv - Biophysics 2022Quote: All media in this study was prepared from granulated Miller’s Luria Broth from Research Products International. Seaplaque low-melting-temperature agarose (VWR ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were then cooled on ice and induced with 1 mM isopropyl-Δ-D-thiogalactoside (IPTG) (Research Products International) at 16 °C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... 5μg/l thiamine (Research Products International) and 1g/l 15NH4Cl (Cambridge Isotope Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... isopropyl β-D-1 thiogalactopyranoside (IPTG) were procured from RPI chemicals (USA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... primary antibody in 2% BSA (Research Products International A30075) in PBST overnight at 4°C with agitation or with 1:5000 beta actin mouse monoclonal antibody (Sigma A5441 ...
-
bioRxiv - Neuroscience 2022Quote: ... After 15 minutes of cooling 25µL of 1:50 dilution of primary p-tau antibody namely either AT8,AT100 or AT180 that recognize different p-tau species were incubated in a tray (RPI, Mt. Prospect, IL #248270) designed for microwave enhanced immunostaining procedures for 3min at power level 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 20 g raffinose (RPI, # R20500-500.0) in 1 L media) ...
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 mm Silica disruption beads (RPI-9834) and a tissue homogenizer (FastPrep-24 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 20 g raffinose (RPI, # R20500-500.0) in 1 L media) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... IPTG was from Research Products International, sodium halides used to create ion chromatography standard curves were from MilliporeSigma ...
-
bioRxiv - Microbiology 2022Quote: ... Agar plates were prepared by addition of 17g agar (Research Products International, Mt. Prospect, IL, USA) per one liter of medium ...