Labshake search
Citations for Origene Technologies :
1 - 50 of 60 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA was obtained by RT-PCR and amplified through PCR using respective primers (OriGene Technologies) followed by agarose gel electrophoresis to assess the gene expression ...
-
A mean-field approach for modeling the propagation of perturbations in biochemical reaction networksbioRxiv - Pharmacology and Toxicology 2021Quote: ... Chop mRNA levels in treated cells were measured using quantitative RT-PCR as previously described [28] using validated primers (OriGene, Cat # HP207450).
-
bioRxiv - Immunology 2022Quote: ... Gene-specific PCR primer pairs were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2019Quote: ... and cloned into pCMV-miR (Origene). To generate replication-deficient adenovirus ...
-
bioRxiv - Cell Biology 2021Quote: ... or a control (pCMV-MIR) purchased from OriGene. After 48 h or 72 h of culturing ...
-
bioRxiv - Cell Biology 2022Quote: ... to create primer sets (Table S1) for cloning and/or subcloning of open-reading frame (ORF) of TMEM163 (purchased from Origene Technologies), SLC30A1/ZNT1 purchased from Origene Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA containing its ORF was inserted into the pCMV-MIR vector (OriGene) to result in pCMV-Aβ175-cDNA ...
-
bioRxiv - Immunology 2022Quote: ... Primers designed by Origene and span at least one intron-exon boundary ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers were purchased from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR primers were from Origene (MyoVa Fw - CTCACACGAACTCCTGCAAA ...
-
bioRxiv - Immunology 2022Quote: ... the following qPCR primers (Origene) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were acquired from OriGene and the following sequences for NOX2 (Mus musculus Cybb ...
-
bioRxiv - Cancer Biology 2022Quote: The plasmid DNA pCMV6-AC and the transfection control pCMV-MIR were purchased from OriGene (Maryland, EEUU). Caco-2 cells were plated (10·106 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... QPCR primer sequences were obtained from OriGene website ...
-
bioRxiv - Cell Biology 2020Quote: ... Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers for ACE2 were obtained from Origene.
-
bioRxiv - Genomics 2023Quote: ... qPCR primer sequences were provided by OriGene or designed by PrimerQuest™ Tool from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... The sequences for the primers were obtained from Origene and primers were obtained from Metabion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Some qPCR primers were purchased from Origene (Table S3). Cycle threshold values were normalized to those of the housekeeping genes GAPDH ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well received 100 ng of the pMIR-REPORT™ Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, Maryland, USA) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Neuroscience 2023Quote: ... Primer sequences were obtained from Origene (MP208179, MP200232 and MP212857). Primer efficiency was calculated and incorporated in the ΔΔCt method analysis [18].
-
bioRxiv - Immunology 2023Quote: ... 0.75 μl of the forward and reverse primer (OriGene, HP205798), and 10.75 μl of RNase-free water were added to each reaction well followed by 1μl of cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... All qPCR primer pair sequences were from OriGene (Rockville, MD).
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific primers were designed using Primer3 or obtained from Origene. Sequences are listed in Table 1.
-
bioRxiv - Immunology 2023Quote: ... 0.75 μl of the forward and reverse primers (OriGene, HP207209 and HP210040) and 9.25 μl of RNase-free water were added to each well followed by 2.5 μl of cDNA.
-
bioRxiv - Cancer Biology 2023Quote: ... Primers targeting beta-Actin (ACTB) (NM_001101) were obtained from Origene (Cat. No. HP204660) and included as the reference gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The purified RT-DNA was prepared for sequencing by first treating with DBR1 (OriGene) to remove the branched RNA ...
-
bioRxiv - Cell Biology 2023Quote: The BAP1 RNA knockdown was performed with a set of 3 unique 27-mer siRNA duplexes targeting BAP1 (Origene, SR305435) using siTrans 1.0 (Origene) ...
-
bioRxiv - Biophysics 2023Quote: ... flag-tagged mTHSD7A construct serving as the PCR template (Origene).
-
bioRxiv - Biochemistry 2023Quote: ... PCR was performed using the human CYP4F2-myc-DDK (OriGene RC216427) plasmid (Forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... expression was carried out in healthy and cancer ovarian tissues by RT-qPCR using Tissuescan™ ovarian cancer cDNA arrays I-IV (Origene Technologies, USA) and EFA6R (NM_206909.3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 CDS was PCR amplified from the TrueORF pCMV-Entry vector (Origene) and cloned via Gibson assembly (NEB ...
-
bioRxiv - Immunology 2019Quote: ... SCF and TPO were amplified by PCR from cDNA expression plasmids (Origene) and cloned into pMX retroviral vectors (vectors details in Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The digested PCR product was ligated into a pCMV6-Entry plasmid (Origene) with T4 DNA ligase ...
-
bioRxiv - Microbiology 2020Quote: ... The murine Sel1L gene was PCR-amplified from pCMV6-Sel1L-Myc-DDK (OriGene) and subcloned in pcDNA3 ...
-
bioRxiv - Neuroscience 2021Quote: ... Bcl6 (NM_009744) was cloned by PCR using a cDNA clone (Cat.No. MC203091, Origene) as template and inserted into CAG-CtlGFP to generate CAG-LSL-Bcl6GFP ...
-
bioRxiv - Microbiology 2021Quote: ... the myc-DDK-tagged-RORC2 cDNA was PCR-amplified from plasmid RC212239 (Origene) and cloned into the MLV-based retroviral vector pMIG Blasti (gift of Jeremy Luban ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Physiology 2021Quote: ... which was obtained by PCR from plasmid pCMV6-EIF2A-GFP (MG209105, OriGene, Rockville, MD) using forward primer 5’-ATTCGTCGACTGGATCCGGT-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length cDNA of TCF7L1 (NM_031283) was PCR-amplified from a commercial plasmid (Origene, SC126274) and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward ...
-
bioRxiv - Cancer Biology 2020Quote: Full-length BAP1 cDNA was amplified by PCR from pCMV6-AC BAP1 plasmid (Origene-SC117256) and cloned into the lentiviral plasmid pCCL-CMV-flT vector ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product and the plasmid pLenti-C-mGFP (# PS100071 OriGene Technologies, Rockville, MD, USA) were digested with Asc1 (#R0558L Bioconcept ...
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Neuroscience 2022Quote: ... The DNA templates were made by PCR amplification from a plasmid pCMV6-mNlgn2(A+)-mycDDK (Origene, catalog #MR222168 ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...