Labshake search
Citations for Origene Technologies :
151 - 200 of 272 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 20 ng/ml) for 24 h in the presence or absence of 10 μg/ml polyclonal anti-NRG1 antibody (Origene, Rockville, MD), 50 μmol/L ErbB4 inhibitor AG1478 (Origene ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with Myc-DDK-tagged Rho-GDI1 (ARHGDIA) (MR202112 OriGene) using Lipofectamine 3000 (L3000015 Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene, TT300003) added to cells in DMEM/10% FBE growth medium for 1 day ...
-
bioRxiv - Cell Biology 2019Quote: ... We transfected HeLa cells with pCMV6-AC-IL2R-GFP (Origene plasmid #RG215768) using TransIT®-2020 transfection reagent (Mirus ...
-
bioRxiv - Cell Biology 2020Quote: ... the gene for NPM was amplified from cDNA library (Jurkat cells, Origene) by PCR and inserted to vectors peGFP-C2 and pmRFP1-C2 (originally Clontech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... YTHDC1 mRNA knockdown in 293T cells was performed using siRNAs (Origene # SR314128) transfected using Lipofectamine RNAiMax (Invitrogen).
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells were individually transfected with plasmids encoding for secreted proteins (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmids for overexpression in HEK293T cells were purchased from OriGene (Rockville, MD): pCMV6 (PS10001) ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a mouse monoclonal antibody OTI5F12 (likely an internal epitope since the full 479 aa sequence was used as an antigen; Origene Technologies, Rockville, MD) were used as capture antibodies for the enrichment of ERG protein from cell lysates (Figure 1B) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 0.5% Bovine Serum Albumin (BSA) and incubated with the following antibodies for 30 minutes: antiCD235a-PE (OriGene Technologies, Rockville, MD, USA), antiCD49d-PB (BD Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Cancer Biology 2020Quote: ... a specified amount of plasmid was transfected into cells using Turbofectin 8.0 (Origene) by following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Biochemistry 2021Quote: U2OS-WT cells were plated and transfected with the pCas9-Guide (Origene GE100002) constructs using Lipofectamine 2000 overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells transduced with the empty pLenti-C-mGFP-P2A-Puro vector (PS100093, OriGene), (HT29GFP and Caco2GFP ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... cells were transduced with pLenti BCL6 ORF-mGFP or empty mGFP only (Origene).
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene, Rockville, MD; TT300003) DMEM/2.5% FBE growth medium for 4 days ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2019Quote: HT1080 cells were transfected with ER-SFGFP-iE using MegaTran 1.0 (OriGene, Cambridge, UK) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001, Origene, MD) and pCMV6/CA-IX vectors (CQ10630 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1×104 cells were mixed with mock or Igfbp2 lentivirus (catalog # MR204287L3V; OriGene Technologies) at MOI=80 in the 500 ml of 10 µg/ml polybrene/DMEM-F12 ...
-
bioRxiv - Cancer Biology 2022Quote: HEK-293T cells were transfected with plasmids overexpressing TurboGFP-tagged PEX3 (OriGene Technologies, RG202031) and Myc-DDK-tagged PEX19 (OriGene Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with 5ug of FOLR3 expression plasmid with FLAG tag (Origene RC212963) using JetPRIME transfection reagent (Polyplus ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-KO VPAC2KO Panc02 cells were similarly transduced with VPAC2-overexpression lentiviral particles (Origene) at 50 MOI for the rescue experiment ...
-
bioRxiv - Biophysics 2022Quote: Transfection of cells was performed transiently with plasmid DNA using Turbofectin 8.0 (PN: TF81001, Origene), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... On DAY4 OTII cells were transduced with C1qbp lentiviral particles (Lenti ORF, C1qbp, Origene, NM_007573) versus Lenti-ORF Control Particles at a multiplicity of infection (MOI ...
-
bioRxiv - Bioengineering 2022Quote: ... A 1:60 dilution of HER2 expressing whole cell lysate in RIPA buffer (Origene LY417979), or a lysate control (Origene LY500001) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 2 and 15 nM siRNA against Nrf-2 (Origene, USA, SR321100) and hTERT (Origene ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were transfected into HAP1 cells seeded on a 6-well plate with Turbofectin (OriGene) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were then incubated with 1:100 dilution of anti-La (Origene Technologies, #TA-00406) and 1:100 dilution of anti-Rab7 (Santa Cruz ...
-
bioRxiv - Cancer Biology 2020Quote: ... PNT1A-HIP1 cells transfected with plasmid expressing scrambled hairpin RNA (Origene, HuSH pRS plasmids #TR312457) supplied within the same kit ...