Labshake search
Citations for Origene Technologies :
101 - 150 of 216 citations for Recombinant Rat Gpt His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The AKT2 complex was incubated with recombinant TFEB (TP760282, Origene) for 15 minutes at 37°C in the presence of 10 nm ATP (A1852-1VL ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the c17orf80 sequence (NM_001100621) amplified from a commercially available tagged ORF clone (OriGene; RC221916L3) and pDEST-pcDNA5-BirA-FLAG vectors (Couzens et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCYT1B (UniProt KB: Q811Q9) recombinant proteins were purchased from Origene. In bacterial expression plasmids for His6-tagged PCYT2β (Uniprot KB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... A plasmid coding for expression of Flag-HA-mNeonGreen-tagged MmULK4 (cDNA: Origene, MR217918; mNeonGreen (mNG) was provided by Allele Biotechnology and Pharmaceuticals (Shaner et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Biochemistry 2023Quote: ... we obtained the WT mS29 gene as a Myc/DDK-tagged ORF from Origene (Cat# RC223182). Using restriction sites AsiSI and PmeI ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 0.25 µg recombinant SLP-76 (OriGene, Cat. TP721201) were then added to the sample and incubated at 30 °C for 60 min ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... Control HCT116 cells (WT) were established by transfecting pCMV6-AC-GFP Tagged Cloning Vector (Origene, Cat # PS100010) into HCT116 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Cell Biology 2021Quote: Myc-DDK tagged Mnr (4933427D14Rik) cDNA in cloned in a pCMV6 plasmid was obtained from Origene (MR211309). hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Cell Biology 2023Quote: A Myc-DDK (FLAG)-tagged coding DNA sequence (CDS) clone of murine Runx2 was purchased from Origene within the pCMV-ENTRY overexpression vector (catalogue number MR227321) ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: HCT116 TP53(-/-) cells were transfected with a FLAG-tagged RIG-I expression vector purchased from Origene (RC217615) using Lipofectamine 3000 in six 150 mm dishes plated to 90% confluency the day before ...
-
bioRxiv - Biochemistry 2023Quote: Myc-DDK-tagged lenti ORF clone of c1orf112 (Lenti-Myc-FLAG-RADIF) was obtained from Origene (RC211444L1). Human FIGNL1 sequence-verified cDNA (FIGNL1-cDNA ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing rat-specific shTET1 was purchased from Origene (#309902). For targeted DNA de-methylation ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and the recombinant Sin1 (also known as MAPKAP1, #TP311745) was purchased from Origene. For the knockdown experiments ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Myc-Flag-RNF114 proteins were purchased from Origene (Origene Technologies Inc., TP309752) or were purified as described previously(Spradlin et al. ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Neuroscience 2019Quote: ... A myc-DDK-tagged aromatase construct (pCMV6-myc-DDK-aromatase) was purchased from Origene (Rockville; Cat. No. MR224509); the pCAG-eGFP has previously been described (Srivastava et al. ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Cancer Biology 2019Quote: Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA). PITX1 ΔHD1 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SLC22A24 (NM_173586 and NM_001136506) tagged open reading frame (ORF) clone and vector control (pCMV6-Entry) were purchased from OriGene. These vectors were either transiently transfected or stably transfected into Flp-In™ 293 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Cancer Biology 2023Quote: ... V5-TKS4 or/and MYC-CD2AP (Myc-DDK-Tagged CD2AP clone) (CAT#: RC210191, Origene Technologies Inc., Rockville, MD) plasmids were transfected using X-tremeGENE Hp DNA Transfection Reagent (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...